\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124465629:

Variant ID: vg0124465629 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24465629
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CTACTACCACCTCTCCTACCATTACATTTACCTCCTCTCTCTCTCTCTCTCTATCTAGTACTCCCTCAGTCTCAAAAAAAAAACTAAAAAAAAAGACAAA[C/T]
CCTGGTTTTCATGCCTAATGTTTGGCCGTCCGTTTTATTTAAAAATTATGAAAAAAATAAAAAGACAAGTCACGCATAAAATATTAATCATGTTTTGTCA

Reverse complement sequence

TGACAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTTATTTTTTTCATAATTTTTAAATAAAACGGACGGCCAAACATTAGGCATGAAAACCAGG[G/A]
TTTGTCTTTTTTTTTAGTTTTTTTTTTGAGACTGAGGGAGTACTAGATAGAGAGAGAGAGAGAGAGGAGGTAAATGTAATGGTAGGAGAGGTGGTAGTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.40% 0.40% 0.25% 59.99% NA
All Indica  2759 4.50% 0.50% 0.14% 94.89% NA
All Japonica  1512 89.00% 0.10% 0.46% 10.45% NA
Aus  269 94.10% 0.00% 0.00% 5.95% NA
Indica I  595 1.20% 1.20% 0.34% 97.31% NA
Indica II  465 2.20% 0.60% 0.00% 97.20% NA
Indica III  913 5.30% 0.00% 0.00% 94.74% NA
Indica Intermediate  786 7.40% 0.50% 0.25% 91.86% NA
Temperate Japonica  767 99.20% 0.00% 0.00% 0.78% NA
Tropical Japonica  504 82.90% 0.20% 1.19% 15.67% NA
Japonica Intermediate  241 68.90% 0.40% 0.41% 30.29% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 56.70% 2.20% 1.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124465629 C -> T LOC_Os01g42960.1 downstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:86.915; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0124465629 C -> T LOC_Os01g42960-LOC_Os01g42970 intergenic_region ; MODIFIER silent_mutation Average:86.915; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0124465629 C -> DEL N N silent_mutation Average:86.915; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124465629 C T -0.01 0.0 0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124465629 6.50E-06 6.50E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 1.43E-06 1.43E-06 mr1009 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 3.82E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 9.90E-33 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 1.24E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 2.36E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 4.25E-41 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 5.89E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 3.58E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 1.02E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 1.62E-17 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 2.53E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 1.27E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 9.47E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 1.98E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 1.01E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 2.04E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 8.10E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 1.52E-59 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 4.42E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 6.64E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124465629 NA 3.42E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251