\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124458449:

Variant ID: vg0124458449 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24458449
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATTATTTTGTGATGGAAAGAGTTCATCATAAAACATGGAAAATACATGGTTTAGAGTGTCCTATTGATTAAAACCCCCCCTAAAAAGATAGAAATAA[C/T]
TGTTTCGATGGAATGCAGGGAAGCGTAGCAATTAGAGGAAAGATAAACACAGACAATTTTTTTTCCATGAATAAAATTCTTCCAAGATCACTATGTTTTG

Reverse complement sequence

CAAAACATAGTGATCTTGGAAGAATTTTATTCATGGAAAAAAAATTGTCTGTGTTTATCTTTCCTCTAATTGCTACGCTTCCCTGCATTCCATCGAAACA[G/A]
TTATTTCTATCTTTTTAGGGGGGGTTTTAATCAATAGGACACTCTAAACCATGTATTTTCCATGTTTTATGATGAACTCTTTCCATCACAAAATAATTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 14.70% 0.44% 0.00% NA
All Indica  2759 96.70% 3.30% 0.04% 0.00% NA
All Japonica  1512 80.80% 17.90% 1.32% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 95.40% 4.60% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.50% 0.13% 0.00% NA
Temperate Japonica  767 76.00% 21.60% 2.35% 0.00% NA
Tropical Japonica  504 86.50% 13.50% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 14.90% 0.83% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124458449 C -> T LOC_Os01g42960.1 upstream_gene_variant ; 2588.0bp to feature; MODIFIER silent_mutation Average:42.327; most accessible tissue: Callus, score: 66.834 N N N N
vg0124458449 C -> T LOC_Os01g42950-LOC_Os01g42960 intergenic_region ; MODIFIER silent_mutation Average:42.327; most accessible tissue: Callus, score: 66.834 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124458449 NA 2.07E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 5.81E-06 mr1008_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 8.26E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 6.07E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 8.29E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 3.32E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 6.18E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 1.07E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 1.83E-06 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 5.46E-06 5.45E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 1.38E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 5.43E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 4.15E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 1.08E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 NA 3.30E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124458449 3.94E-07 3.94E-07 mr1934_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251