\
| Variant ID: vg0124458449 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24458449 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAATTATTTTGTGATGGAAAGAGTTCATCATAAAACATGGAAAATACATGGTTTAGAGTGTCCTATTGATTAAAACCCCCCCTAAAAAGATAGAAATAA[C/T]
TGTTTCGATGGAATGCAGGGAAGCGTAGCAATTAGAGGAAAGATAAACACAGACAATTTTTTTTCCATGAATAAAATTCTTCCAAGATCACTATGTTTTG
CAAAACATAGTGATCTTGGAAGAATTTTATTCATGGAAAAAAAATTGTCTGTGTTTATCTTTCCTCTAATTGCTACGCTTCCCTGCATTCCATCGAAACA[G/A]
TTATTTCTATCTTTTTAGGGGGGGTTTTAATCAATAGGACACTCTAAACCATGTATTTTCCATGTTTTATGATGAACTCTTTCCATCACAAAATAATTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 14.70% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 96.70% | 3.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 80.80% | 17.90% | 1.32% | 0.00% | NA |
| Aus | 269 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 76.00% | 21.60% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 14.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124458449 | C -> T | LOC_Os01g42960.1 | upstream_gene_variant ; 2588.0bp to feature; MODIFIER | silent_mutation | Average:42.327; most accessible tissue: Callus, score: 66.834 | N | N | N | N |
| vg0124458449 | C -> T | LOC_Os01g42950-LOC_Os01g42960 | intergenic_region ; MODIFIER | silent_mutation | Average:42.327; most accessible tissue: Callus, score: 66.834 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124458449 | NA | 2.07E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 5.81E-06 | mr1008_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 8.26E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 6.07E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 8.29E-06 | mr1222_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 3.32E-06 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 6.18E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 1.07E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 1.83E-06 | mr1465_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | 5.46E-06 | 5.45E-06 | mr1547_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 1.38E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 5.43E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 4.15E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 1.08E-06 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | NA | 3.30E-07 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124458449 | 3.94E-07 | 3.94E-07 | mr1934_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |