\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124440740:

Variant ID: vg0124440740 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24440740
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAGCTACTCCTTCACTGGCTGCCGGACCATGATGCGATCGATCGATCGATCCAACTGCACGACGAGACGTTGAAACTGTTATAAGTACCTGCTACAAC[A/G]
ATATACTACTTTCGTCCCAAAATAAGTGCAGCCATGAGTTTCCGCGCCCAACTTTGATCGTTTGTTTTATTTAAAAAATTTTTATAATTAGCATTTTTGT

Reverse complement sequence

ACAAAAATGCTAATTATAAAAATTTTTTAAATAAAACAAACGATCAAAGTTGGGCGCGGAAACTCATGGCTGCACTTATTTTGGGACGAAAGTAGTATAT[T/C]
GTTGTAGCAGGTACTTATAACAGTTTCAACGTCTCGTCGTGCAGTTGGATCGATCGATCGATCGCATCATGGTCCGGCAGCCAGTGAAGGAGTAGCTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 22.00% 15.59% 11.19% NA
All Indica  2759 57.10% 0.30% 24.94% 17.65% NA
All Japonica  1512 34.30% 61.00% 2.51% 2.25% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 54.80% 0.00% 35.63% 9.58% NA
Indica II  465 48.00% 0.00% 27.96% 24.09% NA
Indica III  913 64.40% 0.30% 15.01% 20.26% NA
Indica Intermediate  786 55.90% 0.60% 26.59% 16.92% NA
Temperate Japonica  767 16.30% 83.20% 0.39% 0.13% NA
Tropical Japonica  504 53.20% 34.70% 6.35% 5.75% NA
Japonica Intermediate  241 51.90% 45.20% 1.24% 1.66% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 45.60% 34.40% 11.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124440740 A -> G LOC_Os01g42950.1 downstream_gene_variant ; 4311.0bp to feature; MODIFIER silent_mutation Average:73.537; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg0124440740 A -> G LOC_Os01g42950.2 downstream_gene_variant ; 4311.0bp to feature; MODIFIER silent_mutation Average:73.537; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg0124440740 A -> G LOC_Os01g42950-LOC_Os01g42960 intergenic_region ; MODIFIER silent_mutation Average:73.537; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg0124440740 A -> DEL N N silent_mutation Average:73.537; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124440740 A G -0.01 0.03 0.02 -0.05 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124440740 NA 2.51E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 3.81E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 3.64E-06 NA mr1369_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 6.70E-06 6.70E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 3.56E-06 NA mr1453_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 8.11E-06 8.11E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 8.00E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 1.63E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 5.99E-10 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 5.48E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 1.17E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 4.27E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 3.70E-06 NA mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 2.62E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124440740 NA 1.07E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251