\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124426992:

Variant ID: vg0124426992 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24426992
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGCGACGGGCACCAGCCCTAGCCCGACGTTCATGGTGTTGGTGGCGACCGTGGTGGTGGCGGCGACTCCTCTCCCATCGACGGAGAAGATGGCGAAGG[C/T]
GACGGACGCGCTGATTGCGAGAGAGGCCGAGAACGGCATCCATAATCCAATGAAAGGTAGGCATCGTACCTTCTTTGTTGATTCTTCTGTTCGCTTTTCT

Reverse complement sequence

AGAAAAGCGAACAGAAGAATCAACAAAGAAGGTACGATGCCTACCTTTCATTGGATTATGGATGCCGTTCTCGGCCTCTCTCGCAATCAGCGCGTCCGTC[G/A]
CCTTCGCCATCTTCTCCGTCGATGGGAGAGGAGTCGCCGCCACCACCACGGTCGCCACCAACACCATGAACGTCGGGCTAGGGCTGGTGCCCGTCGCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 29.30% 0.06% 0.00% NA
All Indica  2759 99.20% 0.80% 0.07% 0.00% NA
All Japonica  1512 17.90% 82.10% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.40% 0.13% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 66.10% 0.00% 0.00% NA
Japonica Intermediate  241 37.80% 62.20% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124426992 C -> T LOC_Os01g42920.1 upstream_gene_variant ; 3849.0bp to feature; MODIFIER silent_mutation Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0124426992 C -> T LOC_Os01g42934.1 upstream_gene_variant ; 662.0bp to feature; MODIFIER silent_mutation Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0124426992 C -> T LOC_Os01g42950.1 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0124426992 C -> T LOC_Os01g42950.3 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0124426992 C -> T LOC_Os01g42950.2 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0124426992 C -> T LOC_Os01g42934-LOC_Os01g42950 intergenic_region ; MODIFIER silent_mutation Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124426992 NA 2.32E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 8.45E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 1.88E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 4.64E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 1.84E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 3.08E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 7.56E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 5.14E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 8.27E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 2.55E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 3.06E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 1.31E-37 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 4.59E-11 mr1700_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 1.06E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 1.44E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 9.18E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992 NA 3.49E-49 mr1890_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251