Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124426992:

Variant ID: vg0124426992 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24426992
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGCGACGGGCACCAGCCCTAGCCCGACGTTCATGGTGTTGGTGGCGACCGTGGTGGTGGCGGCGACTCCTCTCCCATCGACGGAGAAGATGGCGAAGG[C/T]
GACGGACGCGCTGATTGCGAGAGAGGCCGAGAACGGCATCCATAATCCAATGAAAGGTAGGCATCGTACCTTCTTTGTTGATTCTTCTGTTCGCTTTTCT

Reverse complement sequence

AGAAAAGCGAACAGAAGAATCAACAAAGAAGGTACGATGCCTACCTTTCATTGGATTATGGATGCCGTTCTCGGCCTCTCTCGCAATCAGCGCGTCCGTC[G/A]
CCTTCGCCATCTTCTCCGTCGATGGGAGAGGAGTCGCCGCCACCACCACGGTCGCCACCAACACCATGAACGTCGGGCTAGGGCTGGTGCCCGTCGCCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.60%	29.30%	0.06%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.07%	0.00%	NA
All Japonica	1512	17.90%	82.10%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	1.40%	0.13%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	33.90%	66.10%	0.00%	0.00%	NA
Japonica Intermediate	241	37.80%	62.20%	0.00%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124426992	C -> T	LOC_Os01g42920.1	upstream_gene_variant ; 3849.0bp to feature; MODIFIER	silent_mutation	Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0124426992	C -> T	LOC_Os01g42934.1	upstream_gene_variant ; 662.0bp to feature; MODIFIER	silent_mutation	Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0124426992	C -> T	LOC_Os01g42950.1	upstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0124426992	C -> T	LOC_Os01g42950.3	upstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0124426992	C -> T	LOC_Os01g42950.2	upstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0124426992	C -> T	LOC_Os01g42934-LOC_Os01g42950	intergenic_region ; MODIFIER	silent_mutation	Average:59.146; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124426992	NA	2.32E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	8.45E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	1.88E-10	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	4.64E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	1.84E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	3.08E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	7.56E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	5.14E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	8.27E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	2.55E-10	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	3.06E-12	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	1.31E-37	mr1689_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	4.59E-11	mr1700_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	1.06E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	1.44E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	9.18E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124426992	NA	3.49E-49	mr1890_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251