| Variant ID: vg0124426824 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24426824 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAAAGATCGCATGGCTCGCCGGGCAGTGTCACCACTGCTGTCCATCCGTGGTAGGCGCAGTACTGCACCCCCTGCACACAGATACGGCGAGGCACGACG[G/A]
CAATCGGAGACGGAGGCGAAGGAGGAGCAACCGGAGTAGTGGCCACCACGATGCGTCGGCGAGGGTGGTGGCGACGGGCACCAGCCCTAGCCCGACGTTC
GAACGTCGGGCTAGGGCTGGTGCCCGTCGCCACCACCCTCGCCGACGCATCGTGGTGGCCACTACTCCGGTTGCTCCTCCTTCGCCTCCGTCTCCGATTG[C/T]
CGTCGTGCCTCGCCGTATCTGTGTGCAGGGGGTGCAGTACTGCGCCTACCACGGATGGACAGCAGTGGTGACACTGCCCGGCGAGCCATGCGATCTTTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 3.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.20% | 9.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 84.70% | 15.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124426824 | G -> A | LOC_Os01g42920.1 | upstream_gene_variant ; 3681.0bp to feature; MODIFIER | silent_mutation | Average:67.579; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0124426824 | G -> A | LOC_Os01g42934.1 | upstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:67.579; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0124426824 | G -> A | LOC_Os01g42950.1 | upstream_gene_variant ; 1816.0bp to feature; MODIFIER | silent_mutation | Average:67.579; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0124426824 | G -> A | LOC_Os01g42950.3 | upstream_gene_variant ; 1816.0bp to feature; MODIFIER | silent_mutation | Average:67.579; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0124426824 | G -> A | LOC_Os01g42950.2 | upstream_gene_variant ; 1816.0bp to feature; MODIFIER | silent_mutation | Average:67.579; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0124426824 | G -> A | LOC_Os01g42934-LOC_Os01g42950 | intergenic_region ; MODIFIER | silent_mutation | Average:67.579; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124426824 | 3.67E-06 | NA | mr1027 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 4.71E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 2.56E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 4.38E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 3.86E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 8.30E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 6.33E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 1.01E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | 9.32E-07 | NA | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 2.11E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124426824 | NA | 4.76E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |