\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124420497:

Variant ID: vg0124420497 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24420497
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCAGAATGATTTGTGGAAGTGGCTACCAGAGTCTGTTTAGAAGACTTCCATGAAATAGCAGTTCCACCTTGTAAAAATACGAATTATGTTTGTGATC[C/T]
AGCATTGTGGGGATCAGATAGATAGCCAGCATTAGTATACCCAATTAAAGTTGAATCCTGGTTCTTTTTAAAGAAAAGTCCAAGATCTCTTATGCCATTA

Reverse complement sequence

TAATGGCATAAGAGATCTTGGACTTTTCTTTAAAAAGAACCAGGATTCAACTTTAATTGGGTATACTAATGCTGGCTATCTATCTGATCCCCACAATGCT[G/A]
GATCACAAACATAATTCGTATTTTTACAAGGTGGAACTGCTATTTCATGGAAGTCTTCTAAACAGACTCTGGTAGCCACTTCCACAAATCATTCTGAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.50% 15.30% 13.84% 48.35% NA
All Indica  2759 1.10% 4.10% 16.78% 78.04% NA
All Japonica  1512 61.00% 22.20% 10.91% 5.89% NA
Aus  269 0.70% 95.50% 3.72% 0.00% NA
Indica I  595 0.70% 0.50% 20.67% 78.15% NA
Indica II  465 0.40% 0.90% 12.04% 86.67% NA
Indica III  913 0.80% 6.40% 18.07% 74.81% NA
Indica Intermediate  786 2.30% 6.00% 15.14% 76.59% NA
Temperate Japonica  767 82.90% 15.80% 0.65% 0.65% NA
Tropical Japonica  504 35.10% 23.40% 25.99% 15.48% NA
Japonica Intermediate  241 45.20% 40.20% 12.03% 2.49% NA
VI/Aromatic  96 78.10% 6.20% 7.29% 8.33% NA
Intermediate  90 35.60% 15.60% 10.00% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124420497 C -> T LOC_Os01g42920.1 missense_variant ; p.Gly805Arg; MODERATE nonsynonymous_codon ; G805R Average:13.196; most accessible tissue: Minghui63 flower, score: 17.517 unknown unknown TOLERATED 1.00
vg0124420497 C -> DEL LOC_Os01g42920.1 N frameshift_variant Average:13.196; most accessible tissue: Minghui63 flower, score: 17.517 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124420497 NA 5.11E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 4.18E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 4.83E-06 NA mr1369_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 6.70E-06 6.70E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 3.89E-06 NA mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 8.11E-06 8.11E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 1.77E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 3.66E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 2.77E-10 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 5.49E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 1.65E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 3.37E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 6.65E-08 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 2.75E-06 NA mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 2.62E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 NA 1.89E-07 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420497 6.19E-06 NA mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251