\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124420479:

Variant ID: vg0124420479 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24420479
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTCATATAATGCAATTATTTCAGAATGATTTGTGGAAGTGGCTACCAGAGTCTGTTTAGAAGACTTCCATGAAATAGCAGTTCCACCTTGTAAAAATA[C/T]
GAATTATGTTTGTGATCCAGCATTGTGGGGATCAGATAGATAGCCAGCATTAGTATACCCAATTAAAGTTGAATCCTGGTTCTTTTTAAAGAAAAGTCCA

Reverse complement sequence

TGGACTTTTCTTTAAAAAGAACCAGGATTCAACTTTAATTGGGTATACTAATGCTGGCTATCTATCTGATCCCCACAATGCTGGATCACAAACATAATTC[G/A]
TATTTTTACAAGGTGGAACTGCTATTTCATGGAAGTCTTCTAAACAGACTCTGGTAGCCACTTCCACAAATCATTCTGAAATAATTGCATTATATGAGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.20% 0.10% 30.83% 39.84% NA
All Indica  2759 6.40% 0.00% 29.68% 63.86% NA
All Japonica  1512 71.60% 0.10% 23.94% 4.37% NA
Aus  269 1.50% 1.50% 91.08% 5.95% NA
Indica I  595 7.60% 0.00% 28.07% 64.37% NA
Indica II  465 3.70% 0.00% 24.52% 71.83% NA
Indica III  913 6.40% 0.00% 31.98% 61.66% NA
Indica Intermediate  786 7.30% 0.10% 31.30% 61.32% NA
Temperate Japonica  767 98.80% 0.00% 0.91% 0.26% NA
Tropical Japonica  504 37.10% 0.00% 51.98% 10.91% NA
Japonica Intermediate  241 57.30% 0.40% 38.59% 3.73% NA
VI/Aromatic  96 80.20% 0.00% 14.58% 5.21% NA
Intermediate  90 43.30% 0.00% 18.89% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124420479 C -> T LOC_Os01g42909.1 upstream_gene_variant ; 3631.0bp to feature; MODIFIER silent_mutation Average:12.814; most accessible tissue: Minghui63 flower, score: 17.517 N N N N
vg0124420479 C -> T LOC_Os01g42920.1 downstream_gene_variant ; 4.0bp to feature; MODIFIER silent_mutation Average:12.814; most accessible tissue: Minghui63 flower, score: 17.517 N N N N
vg0124420479 C -> T LOC_Os01g42934.1 downstream_gene_variant ; 3733.0bp to feature; MODIFIER silent_mutation Average:12.814; most accessible tissue: Minghui63 flower, score: 17.517 N N N N
vg0124420479 C -> T LOC_Os01g42909-LOC_Os01g42920 intergenic_region ; MODIFIER silent_mutation Average:12.814; most accessible tissue: Minghui63 flower, score: 17.517 N N N N
vg0124420479 C -> DEL N N silent_mutation Average:12.814; most accessible tissue: Minghui63 flower, score: 17.517 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124420479 NA 5.19E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 2.78E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 2.67E-08 2.66E-08 mr1159_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 2.04E-06 2.04E-06 mr1184_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 6.46E-06 mr1267_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 1.04E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 4.88E-07 4.88E-07 mr1278_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 3.80E-07 3.80E-07 mr1284_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.11E-07 1.11E-07 mr1286_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 3.81E-06 mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 4.02E-06 4.02E-06 mr1311_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.50E-09 1.50E-09 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 7.48E-06 7.48E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 4.72E-07 4.72E-07 mr1373_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.25E-07 1.25E-07 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 7.37E-07 2.85E-08 mr1397_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.09E-06 1.09E-06 mr1412_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 6.66E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.55E-07 1.55E-07 mr1427_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 8.65E-06 8.65E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 2.45E-06 2.45E-06 mr1524_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 1.26E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.68E-06 1.68E-06 mr1634_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.96E-09 1.96E-09 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 3.72E-06 NA mr1665_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 3.86E-07 2.09E-09 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 7.71E-06 7.70E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 3.22E-06 3.22E-06 mr1674_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 8.74E-06 1.17E-07 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.67E-08 1.67E-08 mr1687_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 5.91E-07 5.90E-07 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 7.00E-07 7.00E-07 mr1700_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 8.15E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 4.99E-06 1.37E-09 mr1738_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 1.19E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 7.39E-06 7.38E-06 mr1747_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 4.99E-07 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 4.33E-06 4.33E-06 mr1766_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 1.65E-16 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.37E-06 1.37E-06 mr1811_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 NA 5.36E-08 mr1812_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 9.09E-06 1.98E-07 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.15E-06 1.15E-06 mr1822_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 6.02E-08 6.02E-08 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 1.75E-06 1.03E-08 mr1833_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 7.15E-08 7.14E-08 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 8.85E-09 8.85E-09 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420479 5.52E-07 5.52E-07 mr1877_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251