\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124420361:

Variant ID: vg0124420361 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24420361
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAACAACACAAGCGGCATTATCTTCATAGATAATGGTAGGTGATTCCAATGAACCAATACCACAAGATGTTAATATGTGGTTAACCATTCTGCGAAGC[T/C]
ATATACATTCACGTGATGCCTCATATAATGCAATTATTTCAGAATGATTTGTGGAAGTGGCTACCAGAGTCTGTTTAGAAGACTTCCATGAAATAGCAGT

Reverse complement sequence

ACTGCTATTTCATGGAAGTCTTCTAAACAGACTCTGGTAGCCACTTCCACAAATCATTCTGAAATAATTGCATTATATGAGGCATCACGTGAATGTATAT[A/G]
GCTTCGCAGAATGGTTAACCACATATTAACATCTTGTGGTATTGGTTCATTGGAATCACCTACCATTATCTATGAAGATAATGCCGCTTGTGTTGTTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 25.10% 3.07% 1.10% NA
All Indica  2759 95.40% 1.10% 2.36% 1.20% NA
All Japonica  1512 25.50% 70.20% 4.03% 0.33% NA
Aus  269 97.40% 1.50% 1.12% 0.00% NA
Indica I  595 94.30% 1.00% 2.69% 2.02% NA
Indica II  465 94.40% 0.60% 3.01% 1.94% NA
Indica III  913 96.60% 1.00% 1.75% 0.66% NA
Indica Intermediate  786 95.30% 1.50% 2.42% 0.76% NA
Temperate Japonica  767 1.30% 97.70% 1.04% 0.00% NA
Tropical Japonica  504 54.60% 36.30% 8.53% 0.60% NA
Japonica Intermediate  241 41.50% 53.50% 4.15% 0.83% NA
VI/Aromatic  96 14.60% 59.40% 13.54% 12.50% NA
Intermediate  90 54.40% 40.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124420361 T -> DEL N N silent_mutation Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 N N N N
vg0124420361 T -> C LOC_Os01g42909.1 upstream_gene_variant ; 3513.0bp to feature; MODIFIER silent_mutation Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 N N N N
vg0124420361 T -> C LOC_Os01g42920.1 downstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 N N N N
vg0124420361 T -> C LOC_Os01g42934.1 downstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 N N N N
vg0124420361 T -> C LOC_Os01g42909-LOC_Os01g42920 intergenic_region ; MODIFIER silent_mutation Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124420361 NA 5.62E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361 NA 8.42E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361 NA 9.19E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361 NA 1.22E-20 mr1657_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361 NA 1.70E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361 5.11E-06 5.11E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361 NA 5.96E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124420361 NA 6.41E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251