\
| Variant ID: vg0124420361 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24420361 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 82. )
CTGAACAACACAAGCGGCATTATCTTCATAGATAATGGTAGGTGATTCCAATGAACCAATACCACAAGATGTTAATATGTGGTTAACCATTCTGCGAAGC[T/C]
ATATACATTCACGTGATGCCTCATATAATGCAATTATTTCAGAATGATTTGTGGAAGTGGCTACCAGAGTCTGTTTAGAAGACTTCCATGAAATAGCAGT
ACTGCTATTTCATGGAAGTCTTCTAAACAGACTCTGGTAGCCACTTCCACAAATCATTCTGAAATAATTGCATTATATGAGGCATCACGTGAATGTATAT[A/G]
GCTTCGCAGAATGGTTAACCACATATTAACATCTTGTGGTATTGGTTCATTGGAATCACCTACCATTATCTATGAAGATAATGCCGCTTGTGTTGTTCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 25.10% | 3.07% | 1.10% | NA |
| All Indica | 2759 | 95.40% | 1.10% | 2.36% | 1.20% | NA |
| All Japonica | 1512 | 25.50% | 70.20% | 4.03% | 0.33% | NA |
| Aus | 269 | 97.40% | 1.50% | 1.12% | 0.00% | NA |
| Indica I | 595 | 94.30% | 1.00% | 2.69% | 2.02% | NA |
| Indica II | 465 | 94.40% | 0.60% | 3.01% | 1.94% | NA |
| Indica III | 913 | 96.60% | 1.00% | 1.75% | 0.66% | NA |
| Indica Intermediate | 786 | 95.30% | 1.50% | 2.42% | 0.76% | NA |
| Temperate Japonica | 767 | 1.30% | 97.70% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 54.60% | 36.30% | 8.53% | 0.60% | NA |
| Japonica Intermediate | 241 | 41.50% | 53.50% | 4.15% | 0.83% | NA |
| VI/Aromatic | 96 | 14.60% | 59.40% | 13.54% | 12.50% | NA |
| Intermediate | 90 | 54.40% | 40.00% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124420361 | T -> DEL | N | N | silent_mutation | Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 | N | N | N | N |
| vg0124420361 | T -> C | LOC_Os01g42909.1 | upstream_gene_variant ; 3513.0bp to feature; MODIFIER | silent_mutation | Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 | N | N | N | N |
| vg0124420361 | T -> C | LOC_Os01g42920.1 | downstream_gene_variant ; 122.0bp to feature; MODIFIER | silent_mutation | Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 | N | N | N | N |
| vg0124420361 | T -> C | LOC_Os01g42934.1 | downstream_gene_variant ; 3851.0bp to feature; MODIFIER | silent_mutation | Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 | N | N | N | N |
| vg0124420361 | T -> C | LOC_Os01g42909-LOC_Os01g42920 | intergenic_region ; MODIFIER | silent_mutation | Average:10.191; most accessible tissue: Zhenshan97 flag leaf, score: 14.661 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124420361 | NA | 5.62E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124420361 | NA | 8.42E-07 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124420361 | NA | 9.19E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124420361 | NA | 1.22E-20 | mr1657_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124420361 | NA | 1.70E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124420361 | 5.11E-06 | 5.11E-06 | mr1832_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124420361 | NA | 5.96E-06 | mr1833_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124420361 | NA | 6.41E-07 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |