\
| Variant ID: vg0124418602 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24418602 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAACTCCAAAATGAAAATGATTAATTAGATTTATGCCACTGTAAATATTGAGGTTTTAAAATATACCATTATAATTTACGTATTTGTAACAATGCCACG[A/G]
TCACTTGTTTATAATTTCAGTTGTACCATTAAGATATGTATTTTACCTGTATTTGATAAAAATGTCCTCACCCTCTGGTGGTCGAGCGGGACAGGTGGAC
GTCCACCTGTCCCGCTCGACCACCAGAGGGTGAGGACATTTTTATCAAATACAGGTAAAATACATATCTTAATGGTACAACTGAAATTATAAACAAGTGA[T/C]
CGTGGCATTGTTACAAATACGTAAATTATAATGGTATATTTTAAAACCTCAATATTTACAGTGGCATAAATCTAATTAATCATTTTCATTTTGGAGTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.00% | 24.80% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 30.20% | 69.40% | 0.40% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.70% | 98.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 67.30% | 32.10% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 43.20% | 56.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124418602 | A -> G | LOC_Os01g42909.1 | upstream_gene_variant ; 1754.0bp to feature; MODIFIER | silent_mutation | Average:56.406; most accessible tissue: Callus, score: 81.33 | N | N | N | N |
| vg0124418602 | A -> G | LOC_Os01g42920.1 | downstream_gene_variant ; 1881.0bp to feature; MODIFIER | silent_mutation | Average:56.406; most accessible tissue: Callus, score: 81.33 | N | N | N | N |
| vg0124418602 | A -> G | LOC_Os01g42909-LOC_Os01g42920 | intergenic_region ; MODIFIER | silent_mutation | Average:56.406; most accessible tissue: Callus, score: 81.33 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124418602 | NA | 7.32E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418602 | NA | 4.56E-45 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418602 | 6.29E-06 | NA | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418602 | NA | 3.74E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418602 | NA | 8.64E-18 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418602 | 2.96E-07 | NA | mr1676_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418602 | 2.09E-06 | 2.01E-08 | mr1676_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418602 | NA | 3.24E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |