\
| Variant ID: vg0124418254 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24418254 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTACTCATCACCTCAGCAAAAACTAGTTTTTCTGAGGAATGGACATGCCTAGGGATGTAAGCGGGACGACCTATGAACCTATTTATATGTTAAATAAA[G/A]
GGTAATCCGCGGGTTTTCACGTCATGGCTCAGCTTGCTGCGTTTATAGAAAAGCAAGTGGGTTAATATATAAACCCATTTATAAGTCAAATTAGTAGGTA
TACCTACTAATTTGACTTATAAATGGGTTTATATATTAACCCACTTGCTTTTCTATAAACGCAGCAAGCTGAGCCATGACGTGAAAACCCGCGGATTACC[C/T]
TTTATTTAACATATAAATAGGTTCATAGGTCGTCCCGCTTACATCCCTAGGCATGTCCATTCCTCAGAAAAACTAGTTTTTGCTGAGGTGATGAGTAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 16.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.50% | 26.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 4.50% | 95.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.70% | 18.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.50% | 46.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124418254 | G -> A | LOC_Os01g42909.1 | upstream_gene_variant ; 1406.0bp to feature; MODIFIER | silent_mutation | Average:51.218; most accessible tissue: Callus, score: 85.517 | N | N | N | N |
| vg0124418254 | G -> A | LOC_Os01g42920.1 | downstream_gene_variant ; 2229.0bp to feature; MODIFIER | silent_mutation | Average:51.218; most accessible tissue: Callus, score: 85.517 | N | N | N | N |
| vg0124418254 | G -> A | LOC_Os01g42909-LOC_Os01g42920 | intergenic_region ; MODIFIER | silent_mutation | Average:51.218; most accessible tissue: Callus, score: 85.517 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124418254 | NA | 7.06E-18 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0124418254 | NA | 5.22E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 1.76E-09 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 2.82E-14 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 4.98E-07 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | 4.80E-09 | 7.56E-26 | mr1164_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 7.36E-08 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 1.29E-16 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 2.15E-21 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 4.66E-15 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | 7.06E-06 | NA | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 2.69E-16 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | 3.17E-07 | 1.16E-11 | mr1851_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124418254 | NA | 1.98E-06 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |