Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0124389643:

Variant ID: vg0124389643 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24389643
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGACTCTATGGAAAGCTAGTTTCGTGGGCTATCAAACCCAATATAAAACATGGTCCAAAACCTTCAAGAGATGTTGAAAAACTTGCAATGAAACCCG[A/G]
TGTAAGTGTTGTGACAAGTGAAACAACTCGGGATTAAAATTTTGGCTTAGGTTTTTCAACTCACACAAACATGAAGCATTTTGAGCACTAGTATTCAACC

Reverse complement sequence

GGTTGAATACTAGTGCTCAAAATGCTTCATGTTTGTGTGAGTTGAAAAACCTAAGCCAAAATTTTAATCCCGAGTTGTTTCACTTGTCACAACACTTACA[T/C]
CGGGTTTCATTGCAAGTTTTTCAACATCTCTTGAAGGTTTTGGACCATGTTTTATATTGGGTTTGATAGCCCACGAAACTAGCTTTCCATAGAGTCCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 21.30% 10.24% 0.32% NA
All Indica  2759 80.80% 6.60% 12.07% 0.54% NA
All Japonica  1512 39.00% 51.90% 9.06% 0.00% NA
Aus  269 97.40% 1.90% 0.74% 0.00% NA
Indica I  595 72.60% 4.20% 22.86% 0.34% NA
Indica II  465 80.90% 6.90% 11.40% 0.86% NA
Indica III  913 86.20% 7.90% 5.26% 0.66% NA
Indica Intermediate  786 80.70% 6.70% 12.21% 0.38% NA
Temperate Japonica  767 11.00% 85.30% 3.78% 0.00% NA
Tropical Japonica  504 75.40% 6.00% 18.65% 0.00% NA
Japonica Intermediate  241 52.30% 41.90% 5.81% 0.00% NA
VI/Aromatic  96 81.20% 12.50% 6.25% 0.00% NA
Intermediate  90 66.70% 26.70% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124389643 A -> G LOC_Os01g42850.1 upstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:27.939; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0124389643 A -> G LOC_Os01g42860.1 upstream_gene_variant ; 3198.0bp to feature; MODIFIER silent_mutation Average:27.939; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0124389643 A -> G LOC_Os01g42850.2 upstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:27.939; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0124389643 A -> G LOC_Os01g42850-LOC_Os01g42860 intergenic_region ; MODIFIER silent_mutation Average:27.939; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0124389643 A -> DEL N N silent_mutation Average:27.939; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124389643 NA 4.25E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124389643 NA 3.06E-20 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124389643 NA 5.30E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124389643 NA 6.90E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.48E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.50E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 3.62E-07 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.91E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.33E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 5.05E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 5.84E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.92E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 3.02E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.92E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.36E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 7.96E-15 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.69E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 7.94E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.71E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.79E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 9.18E-08 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 3.94E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.98E-07 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.49E-10 mr1346_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.96E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 3.20E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 6.89E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 8.44E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.86E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 9.16E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.92E-08 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.02E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.63E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 6.33E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 8.17E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 3.23E-07 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.83E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 8.77E-34 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.45E-13 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 6.71E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 8.40E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 7.05E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.74E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 7.85E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.51E-13 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 7.18E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.66E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 3.35E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.56E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.35E-09 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 7.74E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.00E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.27E-13 mr1803_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.73E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 3.76E-32 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.81E-13 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.48E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 7.20E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.20E-11 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.47E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 2.05E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 4.62E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.32E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124389643 NA 1.74E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251