\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124366565:

Variant ID: vg0124366565 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24366565
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAAAGTTGCCTAAACTTTGGTACTACCAAGATTTTAGTATAGCACCAAACCAAACTGGCCCTAACTTTTAGGTGGCAATTTAAAAGCTATATATTTGAG[A/T]
TAGGCTGTGTTTAGTTCGGCCCAAAGTTTAGAATTTGGTTAAAATTAGAGACGATGTGACTGAAAAGTTGTGTGTGTATGAAAGATTTGATGTGATGGAA

Reverse complement sequence

TTCCATCACATCAAATCTTTCATACACACACAACTTTTCAGTCACATCGTCTCTAATTTTAACCAAATTCTAAACTTTGGGCCGAACTAAACACAGCCTA[T/A]
CTCAAATATATAGCTTTTAAATTGCCACCTAAAAGTTAGGGCCAGTTTGGTTTGGTGCTATACTAAAATCTTGGTAGTACCAAAGTTTAGGCAACTTTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 28.00% 0.04% 0.00% NA
All Indica  2759 99.60% 0.30% 0.04% 0.00% NA
All Japonica  1512 20.70% 79.30% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.00% 0.13% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 53.80% 46.20% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 85.50% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 78.10% 1.04% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124366565 A -> T LOC_Os01g42820.1 downstream_gene_variant ; 2964.0bp to feature; MODIFIER silent_mutation Average:75.511; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0124366565 A -> T LOC_Os01g42820.2 downstream_gene_variant ; 2159.0bp to feature; MODIFIER silent_mutation Average:75.511; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0124366565 A -> T LOC_Os01g42820.3 downstream_gene_variant ; 2159.0bp to feature; MODIFIER silent_mutation Average:75.511; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0124366565 A -> T LOC_Os01g42810.1 intron_variant ; MODIFIER silent_mutation Average:75.511; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124366565 A T 0.01 0.02 0.02 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124366565 NA 3.23E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 9.75E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 1.75E-17 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 2.89E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 1.31E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 7.63E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 7.38E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 1.46E-21 mr1304 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 2.95E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 4.80E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 4.17E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 7.89E-32 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 8.85E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 3.38E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 3.29E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 1.55E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 5.26E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 2.54E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 1.92E-16 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124366565 NA 1.31E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251