\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124339287:

Variant ID: vg0124339287 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24339287
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAAACGGACAAAAAAATTCCAATTGGACAAGAAAGATAGAAAATAGTGAAAACGGACAAGAAAAATAGAAATTCCAATTTTAATCAAGAAAAAAGAGA[G/A]
AAAAAATAACCATTGGGTCATAGTAGATCCAGATTATAACAGTTTAGATTTAATATAGGGTGTGTTTAGATTCCAAAATTTGTTTGCCAAAAACGTCACA

Reverse complement sequence

TGTGACGTTTTTGGCAAACAAATTTTGGAATCTAAACACACCCTATATTAAATCTAAACTGTTATAATCTGGATCTACTATGACCCAATGGTTATTTTTT[C/T]
TCTCTTTTTTCTTGATTAAAATTGGAATTTCTATTTTTCTTGTCCGTTTTCACTATTTTCTATCTTTCTTGTCCAATTGGAATTTTTTTGTCCGTTTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.30% 0.08% 0.00% NA
All Indica  2759 95.10% 4.80% 0.07% 0.00% NA
All Japonica  1512 82.10% 17.80% 0.13% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 93.10% 6.80% 0.11% 0.00% NA
Indica Intermediate  786 92.40% 7.50% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 53.00% 46.60% 0.40% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124339287 G -> A LOC_Os01g42770.1 upstream_gene_variant ; 1927.0bp to feature; MODIFIER silent_mutation Average:44.065; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0124339287 G -> A LOC_Os01g42760.1 downstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:44.065; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0124339287 G -> A LOC_Os01g42780.1 downstream_gene_variant ; 4231.0bp to feature; MODIFIER silent_mutation Average:44.065; most accessible tissue: Minghui63 flower, score: 60.203 N N N N
vg0124339287 G -> A LOC_Os01g42760-LOC_Os01g42770 intergenic_region ; MODIFIER silent_mutation Average:44.065; most accessible tissue: Minghui63 flower, score: 60.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124339287 NA 1.48E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 1.82E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 6.12E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 1.12E-07 5.76E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 3.15E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 4.27E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 6.00E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 4.75E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 2.26E-17 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 7.78E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 5.54E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 4.49E-08 4.49E-08 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 1.32E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 3.11E-06 8.56E-09 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 2.56E-08 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 4.91E-07 3.39E-09 mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 9.45E-07 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 1.58E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 5.13E-08 4.27E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 7.06E-06 NA mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 6.26E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 8.40E-07 8.40E-07 mr1145_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 8.03E-07 NA mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 1.29E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 1.32E-06 8.53E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 6.74E-06 NA mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 8.16E-06 5.31E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 4.78E-06 NA mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 4.53E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124339287 NA 1.11E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251