Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124310778:

Variant ID: vg0124310778 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 24310778
Reference Allele: TAlternative Allele: A,TAAA,TAAAA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.01, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAATTGGGACGACGGAGCGATGTAAAGAATTAGATAAGTTAGAAAGGGAAATGCTGTATTACAAATTTACGAGCCCTCTCATCCACGTAAAAAAAAAT[T/A,TAAA,TAAAA]
ATACTACTAGCTCTGTCACCTGGCACGTAAATGATAGTGACGTGCAATTAGTTGATACTGTGATTTTTCTCATTGGTTAGATCGCACGTGCACGGTAAGA

Reverse complement sequence

TCTTACCGTGCACGTGCGATCTAACCAATGAGAAAAATCACAGTATCAACTAATTGCACGTCACTATCATTTACGTGCCAGGTGACAGAGCTAGTAGTAT[A/T,TTTA,TTTTA]
ATTTTTTTTTACGTGGATGAGAGGGCTCGTAAATTTGTAATACAGCATTTCCCTTTCTAACTTATCTAATTCTTTACATCGCTCCGTCGTCCCAATTCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 42.10% 0.76% 3.39% TAAA: 0.83%; TAAAA: 0.02%
All Indica  2759 88.10% 9.60% 0.62% 0.22% TAAA: 1.41%; TAAAA: 0.04%
All Japonica  1512 2.10% 87.50% 0.53% 9.92% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 93.90% 5.70% 0.34% 0.00% NA
Indica II  465 94.40% 4.10% 1.08% 0.43% NA
Indica III  913 84.90% 10.50% 0.55% 0.00% TAAA: 3.94%; TAAAA: 0.11%
Indica Intermediate  786 83.60% 14.90% 0.64% 0.51% TAAA: 0.38%
Temperate Japonica  767 0.40% 99.20% 0.00% 0.39% NA
Tropical Japonica  504 4.80% 67.30% 1.19% 26.79% NA
Japonica Intermediate  241 1.70% 92.50% 0.83% 4.98% NA
VI/Aromatic  96 2.10% 87.50% 10.42% 0.00% NA
Intermediate  90 40.00% 54.40% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124310778 T -> A LOC_Os01g42730.1 upstream_gene_variant ; 1823.0bp to feature; MODIFIER silent_mutation Average:80.926; most accessible tissue: Minghui63 flag leaf, score: 97.894 N N N N
vg0124310778 T -> A LOC_Os01g42720-LOC_Os01g42730 intergenic_region ; MODIFIER silent_mutation Average:80.926; most accessible tissue: Minghui63 flag leaf, score: 97.894 N N N N
vg0124310778 T -> TAAA LOC_Os01g42730.1 upstream_gene_variant ; 1822.0bp to feature; MODIFIER silent_mutation Average:80.926; most accessible tissue: Minghui63 flag leaf, score: 97.894 N N N N
vg0124310778 T -> TAAA LOC_Os01g42720-LOC_Os01g42730 intergenic_region ; MODIFIER silent_mutation Average:80.926; most accessible tissue: Minghui63 flag leaf, score: 97.894 N N N N
vg0124310778 T -> TAAAA LOC_Os01g42730.1 upstream_gene_variant ; 1822.0bp to feature; MODIFIER silent_mutation Average:80.926; most accessible tissue: Minghui63 flag leaf, score: 97.894 N N N N
vg0124310778 T -> TAAAA LOC_Os01g42720-LOC_Os01g42730 intergenic_region ; MODIFIER silent_mutation Average:80.926; most accessible tissue: Minghui63 flag leaf, score: 97.894 N N N N
vg0124310778 T -> DEL N N silent_mutation Average:80.926; most accessible tissue: Minghui63 flag leaf, score: 97.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124310778 T A 0.16 0.17 0.11 0.02 0.11 0.11
vg0124310778 T TAAA 0.19 0.16 0.16 -0.11 -0.03 -0.06
vg0124310778 T TAAAA 0.17 -0.12 0.06 -0.04 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124310778 NA 1.46E-47 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 2.80E-20 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.23E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 4.73E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 5.27E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.11E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.11E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 8.90E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.09E-06 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.13E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 3.55E-09 mr1765 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.17E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.29E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 2.24E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 6.82E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 8.41E-49 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 2.03E-58 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 4.96E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 6.71E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.15E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 1.24E-27 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 7.24E-27 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 8.79E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124310778 NA 5.71E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251