\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124267851:

Variant ID: vg0124267851 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24267851
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTTGTGTCGTCTCTCTATCCTTTGTTAGAAATTGTTATACTTGGTTTTCAACCAAAAATTATGTACTAAGTGGCTATAGCTTTAGTTGAAGTAAAGG[C/A]
CAGATATTATATGTTATCTAAAGAAATCATCATTCAAATCAAGGAGACCGAATGAAAAGCCTATATATTGTTCATAGTCTTACGCTCATATAGCTTAGAA

Reverse complement sequence

TTCTAAGCTATATGAGCGTAAGACTATGAACAATATATAGGCTTTTCATTCGGTCTCCTTGATTTGAATGATGATTTCTTTAGATAACATATAATATCTG[G/T]
CCTTTACTTCAACTAAAGCTATAGCCACTTAGTACATAATTTTTGGTTGAAAACCAAGTATAACAATTTCTAACAAAGGATAGAGAGACGACACAAGAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.50% 0.40% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 90.50% 8.50% 0.99% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 87.10% 11.10% 1.83% 0.00% NA
Tropical Japonica  504 92.70% 7.10% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 79.20% 2.08% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124267851 C -> A LOC_Os01g42670.1 upstream_gene_variant ; 1940.0bp to feature; MODIFIER silent_mutation Average:54.641; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0124267851 C -> A LOC_Os01g42660.1 downstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:54.641; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0124267851 C -> A LOC_Os01g42660-LOC_Os01g42670 intergenic_region ; MODIFIER silent_mutation Average:54.641; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124267851 NA 2.47E-20 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124267851 9.11E-07 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 NA 3.80E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 4.80E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 2.40E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 1.23E-06 NA mr1395 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 1.87E-07 NA mr1517 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 5.00E-06 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 NA 2.47E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 3.76E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 5.19E-06 7.11E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124267851 NA 3.08E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251