\
| Variant ID: vg0124267851 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24267851 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 295. )
ATTCTTGTGTCGTCTCTCTATCCTTTGTTAGAAATTGTTATACTTGGTTTTCAACCAAAAATTATGTACTAAGTGGCTATAGCTTTAGTTGAAGTAAAGG[C/A]
CAGATATTATATGTTATCTAAAGAAATCATCATTCAAATCAAGGAGACCGAATGAAAAGCCTATATATTGTTCATAGTCTTACGCTCATATAGCTTAGAA
TTCTAAGCTATATGAGCGTAAGACTATGAACAATATATAGGCTTTTCATTCGGTCTCCTTGATTTGAATGATGATTTCTTTAGATAACATATAATATCTG[G/T]
CCTTTACTTCAACTAAAGCTATAGCCACTTAGTACATAATTTTTGGTTGAAAACCAAGTATAACAATTTCTAACAAAGGATAGAGAGACGACACAAGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.50% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 90.50% | 8.50% | 0.99% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 87.10% | 11.10% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 7.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 79.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124267851 | C -> A | LOC_Os01g42670.1 | upstream_gene_variant ; 1940.0bp to feature; MODIFIER | silent_mutation | Average:54.641; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0124267851 | C -> A | LOC_Os01g42660.1 | downstream_gene_variant ; 1352.0bp to feature; MODIFIER | silent_mutation | Average:54.641; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0124267851 | C -> A | LOC_Os01g42660-LOC_Os01g42670 | intergenic_region ; MODIFIER | silent_mutation | Average:54.641; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124267851 | NA | 2.47E-20 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0124267851 | 9.11E-07 | NA | mr1071 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | NA | 3.80E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | 4.80E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | 2.40E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | 1.23E-06 | NA | mr1395 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | 1.87E-07 | NA | mr1517 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | 5.00E-06 | NA | mr1613 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | NA | 2.47E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | 3.76E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | 5.19E-06 | 7.11E-07 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124267851 | NA | 3.08E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |