\
| Variant ID: vg0124266409 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24266409 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )
CCAGTTCCCATCCTGACTACACCATTGATCGTGCGAGTGCTTCTTTCGTAACTCGACGACTCAACGATTGGGATTGGGGACCCGTGTCCAACGGGGGCAA[T/C]
CGGCGTCTGGCGACTAGGATCGAGAGCAGCGTTCAGCAAGCAGCTATGTCACTATGTCAGTTTCGGTTCGATTTTAGAAATTCCGATTAGAATTGGATTG
CAATCCAATTCTAATCGGAATTTCTAAAATCGAACCGAAACTGACATAGTGACATAGCTGCTTGCTGAACGCTGCTCTCGATCCTAGTCGCCAGACGCCG[A/G]
TTGCCCCCGTTGGACACGGGTCCCCAATCCCAATCGTTGAGTCGTCGAGTTACGAAAGAAGCACTCGCACGATCAATGGTGTAGTCAGGATGGGAACTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 24.00% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 27.20% | 71.80% | 0.99% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 12.40% | 86.20% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 54.40% | 44.80% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 8.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124266409 | T -> C | LOC_Os01g42660.1 | synonymous_variant ; p.Asn82Asn; LOW | synonymous_codon | Average:48.576; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124266409 | 2.42E-08 | 2.28E-30 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | 7.06E-07 | 8.40E-31 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | 7.45E-08 | 4.72E-22 | mr1484 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | NA | 6.14E-06 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | NA | 9.51E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | NA | 3.72E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | 9.75E-07 | 1.82E-26 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | NA | 4.28E-15 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | 1.85E-06 | 2.11E-13 | mr1945 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | NA | 1.69E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | 1.20E-06 | 1.34E-30 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | 4.26E-06 | 3.66E-27 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | 3.37E-07 | 1.18E-35 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | NA | 2.81E-22 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124266409 | NA | 9.31E-20 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |