\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124234030:

Variant ID: vg0124234030 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24234030
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCTAGTAATTAAAAGCGTCGATTAATCAATGCCCACACTAAAATTCTAACAAAAACGGATCTGTATATATATAATTATGGATAAGTGCACCATACTCC[T/C]
TTCGTCCTATTTTCATCATCACCTAAGCAAATAGCGTAGAGACCAAGGACAACTAAACCTTTATCATTCTATAATTAATTCTCATCGATTAAGGTAATAT

Reverse complement sequence

ATATTACCTTAATCGATGAGAATTAATTATAGAATGATAAAGGTTTAGTTGTCCTTGGTCTCTACGCTATTTGCTTAGGTGATGATGAAAATAGGACGAA[A/G]
GGAGTATGGTGCACTTATCCATAATTATATATATACAGATCCGTTTTTGTTAGAATTTTAGTGTGGGCATTGATTAATCGACGCTTTTAATTACTAGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.70% 0.04% 0.00% NA
All Indica  2759 87.40% 12.50% 0.07% 0.00% NA
All Japonica  1512 92.70% 7.30% 0.00% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 89.90% 9.90% 0.17% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 84.40% 15.60% 0.00% 0.00% NA
Indica Intermediate  786 83.60% 16.30% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 82.90% 17.10% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124234030 T -> C LOC_Os01g42610.1 upstream_gene_variant ; 599.0bp to feature; MODIFIER silent_mutation Average:60.217; most accessible tissue: Callus, score: 76.336 N N N N
vg0124234030 T -> C LOC_Os01g42600.1 downstream_gene_variant ; 3877.0bp to feature; MODIFIER silent_mutation Average:60.217; most accessible tissue: Callus, score: 76.336 N N N N
vg0124234030 T -> C LOC_Os01g42600-LOC_Os01g42610 intergenic_region ; MODIFIER silent_mutation Average:60.217; most accessible tissue: Callus, score: 76.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124234030 NA 6.20E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 6.70E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 1.81E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 1.57E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 6.08E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 7.18E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 3.19E-11 mr1792_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 6.45E-17 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124234030 NA 4.16E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251