\
| Variant ID: vg0124234030 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24234030 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.24, others allele: 0.00, population size: 195. )
ATCCTAGTAATTAAAAGCGTCGATTAATCAATGCCCACACTAAAATTCTAACAAAAACGGATCTGTATATATATAATTATGGATAAGTGCACCATACTCC[T/C]
TTCGTCCTATTTTCATCATCACCTAAGCAAATAGCGTAGAGACCAAGGACAACTAAACCTTTATCATTCTATAATTAATTCTCATCGATTAAGGTAATAT
ATATTACCTTAATCGATGAGAATTAATTATAGAATGATAAAGGTTTAGTTGTCCTTGGTCTCTACGCTATTTGCTTAGGTGATGATGAAAATAGGACGAA[A/G]
GGAGTATGGTGCACTTATCCATAATTATATATATACAGATCCGTTTTTGTTAGAATTTTAGTGTGGGCATTGATTAATCGACGCTTTTAATTACTAGGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.30% | 15.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 87.40% | 12.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.90% | 9.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 16.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124234030 | T -> C | LOC_Os01g42610.1 | upstream_gene_variant ; 599.0bp to feature; MODIFIER | silent_mutation | Average:60.217; most accessible tissue: Callus, score: 76.336 | N | N | N | N |
| vg0124234030 | T -> C | LOC_Os01g42600.1 | downstream_gene_variant ; 3877.0bp to feature; MODIFIER | silent_mutation | Average:60.217; most accessible tissue: Callus, score: 76.336 | N | N | N | N |
| vg0124234030 | T -> C | LOC_Os01g42600-LOC_Os01g42610 | intergenic_region ; MODIFIER | silent_mutation | Average:60.217; most accessible tissue: Callus, score: 76.336 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124234030 | NA | 6.20E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 6.70E-07 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 1.81E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 1.57E-07 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 6.08E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 7.18E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 3.19E-11 | mr1792_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 6.45E-17 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124234030 | NA | 4.16E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |