\
| Variant ID: vg0124212768 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24212768 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 236. )
GTCAATTGGATGATCCTTGGAAAGAGCGGTGTGTATCCTTAGTGGCATAGGTGGATCTTGTGCCTTCTCCTCCTCCACTTCAACTTGAGCTTGACTTGGC[G/A]
TAGCGGAAGTAGATGGCTCATCTTGAGTGGAGGTGGATGGCTTGTCTTCCACTTCAATAGGCTTGACATTTCCAATAGACATGTTCTTCATAGCTCTCAT
ATGAGAGCTATGAAGAACATGTCTATTGGAAATGTCAAGCCTATTGAAGTGGAAGACAAGCCATCCACCTCCACTCAAGATGAGCCATCTACTTCCGCTA[C/T]
GCCAAGTCAAGCTCAAGTTGAAGTGGAGGAGGAGAAGGCACAAGATCCACCTATGCCACTAAGGATACACACCGCTCTTTCCAAGGATCATCCAATTGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 48.80% | 0.21% | 0.13% | NA |
| All Indica | 2759 | 85.50% | 14.10% | 0.22% | 0.14% | NA |
| All Japonica | 1512 | 0.50% | 99.30% | 0.07% | 0.07% | NA |
| Aus | 269 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 10.80% | 0.17% | 0.17% | NA |
| Indica II | 465 | 95.50% | 4.30% | 0.00% | 0.22% | NA |
| Indica III | 913 | 83.70% | 16.00% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 79.30% | 20.20% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 58.90% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124212768 | G -> A | LOC_Os01g42590.1 | missense_variant ; p.Thr380Met; MODERATE | nonsynonymous_codon ; T380M | Average:31.303; most accessible tissue: Minghui63 panicle, score: 46.754 | probably damaging |
2.408 |
TOLERATED | 0.16 |
| vg0124212768 | G -> DEL | LOC_Os01g42590.1 | N | frameshift_variant | Average:31.303; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124212768 | NA | 2.81E-32 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 5.85E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 3.48E-15 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 2.28E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 1.36E-16 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 4.39E-13 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 5.28E-50 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 9.82E-07 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 8.67E-24 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | 4.32E-06 | NA | mr1792_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 2.12E-06 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 2.40E-06 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 6.25E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 3.84E-20 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124212768 | NA | 3.91E-29 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |