\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124208765:

Variant ID: vg0124208765 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24208765
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GACTATGTCACACTTGGCAACATGGTCTCTTAGGAAGTGATGGCGAATGTCAATATGCTTGGTTCTAGAATGTTGGACCAGGTTATTGGCTATCTTTATG[G/A]
CACTATCATTGTCACATAGGAGTGAGGTTTTGGTAAAGGATATGTCATAGTCTAACAAGGTTTGTTTCATCCAAAGCAATTGGGCACAACAACTACCCGC

Reverse complement sequence

GCGGGTAGTTGTTGTGCCCAATTGCTTTGGATGAAACAAACCTTGTTAGACTATGACATATCCTTTACCAAAACCTCACTCCTATGTGACAATGATAGTG[C/T]
CATAAAGATAGCCAATAACCTGGTCCAACATTCTAGAACCAAGCATATTGACATTCGCCATCACTTCCTAAGAGACCATGTTGCCAAGTGTGACATAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 2.00% 1.06% 0.00% NA
All Indica  2759 94.90% 3.40% 1.78% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 80.30% 12.40% 7.23% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.20% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124208765 G -> A LOC_Os01g42570.1 upstream_gene_variant ; 4362.0bp to feature; MODIFIER silent_mutation Average:28.875; most accessible tissue: Minghui63 flower, score: 40.98 N N N N
vg0124208765 G -> A LOC_Os01g42580.1 upstream_gene_variant ; 2093.0bp to feature; MODIFIER silent_mutation Average:28.875; most accessible tissue: Minghui63 flower, score: 40.98 N N N N
vg0124208765 G -> A LOC_Os01g42590.1 downstream_gene_variant ; 808.0bp to feature; MODIFIER silent_mutation Average:28.875; most accessible tissue: Minghui63 flower, score: 40.98 N N N N
vg0124208765 G -> A LOC_Os01g42580-LOC_Os01g42590 intergenic_region ; MODIFIER silent_mutation Average:28.875; most accessible tissue: Minghui63 flower, score: 40.98 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124208765 NA 2.85E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124208765 1.60E-06 NA mr1743 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124208765 NA 5.39E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124208765 NA 5.39E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251