Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124205775:

Variant ID: vg0124205775 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24205775
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TATGCCCGGTAGACAAGCGTTGAATGCTTTCACTTAGGGTATTAATAGCCCCAAGTACCGGGTAGAAGTATTCATTGGGTTGCATTTCAAAGTAAGCATA[T/C]
TGTGGATGGAAGAAAGCATTTGGATCATACCCATGAGGAGGAGGAGGTGCTGAGCTTTAGCTAGCTCCAGGGTGAGAAGAAGGCACCGTCCTAGGAGCAC

Reverse complement sequence

GTGCTCCTAGGACGGTGCCTTCTTCTCACCCTGGAGCTAGCTAAAGCTCAGCACCTCCTCCTCCTCATGGGTATGATCCAAATGCTTTCTTCCATCCACA[A/G]
TATGCTTACTTTGAAATGCAACCCAATGAATACTTCTACCCGGTACTTGGGGCTATTAATACCCTAAGTGAAAGCATTCAACGCTTGTCTACCGGGCATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.40%	15.20%	1.38%	0.00%	NA
All Indica	2759	99.50%	0.40%	0.11%	0.00%	NA
All Japonica	1512	50.50%	45.50%	3.97%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	0.80%	0.25%	0.00%	NA
Temperate Japonica	767	35.20%	58.30%	6.52%	0.00%	NA
Tropical Japonica	504	69.20%	30.60%	0.20%	0.00%	NA
Japonica Intermediate	241	60.20%	36.10%	3.73%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124205775	T -> C	LOC_Os01g42570.1	upstream_gene_variant ; 1372.0bp to feature; MODIFIER	silent_mutation	Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0124205775	T -> C	LOC_Os01g42580.1	downstream_gene_variant ; 151.0bp to feature; MODIFIER	silent_mutation	Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0124205775	T -> C	LOC_Os01g42590.1	downstream_gene_variant ; 3798.0bp to feature; MODIFIER	silent_mutation	Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0124205775	T -> C	LOC_Os01g42570-LOC_Os01g42580	intergenic_region ; MODIFIER	silent_mutation	Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124205775	NA	4.10E-15	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124205775	NA	8.59E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.92E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	3.72E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.55E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	1.47E-06	1.47E-06	mr1773	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	6.28E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	6.86E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	6.01E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.73E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.27E-06	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	3.65E-06	6.46E-08	mr1296_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.37E-06	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.59E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	4.14E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.11E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	5.66E-06	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	2.20E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	3.37E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.37E-16	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	1.08E-09	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	6.26E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	8.16E-09	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775	NA	3.90E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251