\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124205775:

Variant ID: vg0124205775 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24205775
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCCCGGTAGACAAGCGTTGAATGCTTTCACTTAGGGTATTAATAGCCCCAAGTACCGGGTAGAAGTATTCATTGGGTTGCATTTCAAAGTAAGCATA[T/C]
TGTGGATGGAAGAAAGCATTTGGATCATACCCATGAGGAGGAGGAGGTGCTGAGCTTTAGCTAGCTCCAGGGTGAGAAGAAGGCACCGTCCTAGGAGCAC

Reverse complement sequence

GTGCTCCTAGGACGGTGCCTTCTTCTCACCCTGGAGCTAGCTAAAGCTCAGCACCTCCTCCTCCTCATGGGTATGATCCAAATGCTTTCTTCCATCCACA[A/G]
TATGCTTACTTTGAAATGCAACCCAATGAATACTTCTACCCGGTACTTGGGGCTATTAATACCCTAAGTGAAAGCATTCAACGCTTGTCTACCGGGCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 15.20% 1.38% 0.00% NA
All Indica  2759 99.50% 0.40% 0.11% 0.00% NA
All Japonica  1512 50.50% 45.50% 3.97% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.80% 0.25% 0.00% NA
Temperate Japonica  767 35.20% 58.30% 6.52% 0.00% NA
Tropical Japonica  504 69.20% 30.60% 0.20% 0.00% NA
Japonica Intermediate  241 60.20% 36.10% 3.73% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124205775 T -> C LOC_Os01g42570.1 upstream_gene_variant ; 1372.0bp to feature; MODIFIER silent_mutation Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0124205775 T -> C LOC_Os01g42580.1 downstream_gene_variant ; 151.0bp to feature; MODIFIER silent_mutation Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0124205775 T -> C LOC_Os01g42590.1 downstream_gene_variant ; 3798.0bp to feature; MODIFIER silent_mutation Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0124205775 T -> C LOC_Os01g42570-LOC_Os01g42580 intergenic_region ; MODIFIER silent_mutation Average:40.946; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124205775 NA 4.10E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124205775 NA 8.59E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.92E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 3.72E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.55E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 1.47E-06 1.47E-06 mr1773 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 6.28E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 6.86E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 6.01E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.73E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.27E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 3.65E-06 6.46E-08 mr1296_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.37E-06 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.59E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 4.14E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.11E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 5.66E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 2.20E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 3.37E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.37E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 1.08E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 6.26E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 8.16E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124205775 NA 3.90E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251