\
| Variant ID: vg0124176064 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24176064 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCGGCTCCTTAATTCCCAAATCATGGCTTTGTTCCCGGGTAAAAAGCACCATTCCAGTAGGTAAAAAATATTCTAAACTCTTAAGGGACATTCACTCCTT[G/A]
TTTCACTCCTTGTTTGTACGTCATCTAAATGATTATAATGAAACTTTAAAAAAATCAACAAAAGATATTAATATGTGATAAATCACTCTAGAAACATACA
TGTATGTTTCTAGAGTGATTTATCACATATTAATATCTTTTGTTGATTTTTTTAAAGTTTCATTATAATCATTTAGATGACGTACAAACAAGGAGTGAAA[C/T]
AAGGAGTGAATGTCCCTTAAGAGTTTAGAATATTTTTTACCTACTGGAATGGTGCTTTTTACCCGGGAACAAAGCCATGATTTGGGAATTAAGGAGCCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.50% | 0.02% | 0.36% | NA |
| All Indica | 2759 | 99.50% | 0.00% | 0.00% | 0.51% | NA |
| All Japonica | 1512 | 95.20% | 4.60% | 0.07% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.00% | 0.50% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.00% | 0.00% | 0.55% | NA |
| Indica Intermediate | 786 | 99.10% | 0.10% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124176064 | G -> A | LOC_Os01g42510.1 | upstream_gene_variant ; 4623.0bp to feature; MODIFIER | silent_mutation | Average:57.784; most accessible tissue: Callus, score: 76.703 | N | N | N | N |
| vg0124176064 | G -> A | LOC_Os01g42510.2 | upstream_gene_variant ; 4623.0bp to feature; MODIFIER | silent_mutation | Average:57.784; most accessible tissue: Callus, score: 76.703 | N | N | N | N |
| vg0124176064 | G -> A | LOC_Os01g42510-LOC_Os01g42520 | intergenic_region ; MODIFIER | silent_mutation | Average:57.784; most accessible tissue: Callus, score: 76.703 | N | N | N | N |
| vg0124176064 | G -> DEL | N | N | silent_mutation | Average:57.784; most accessible tissue: Callus, score: 76.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124176064 | 8.22E-07 | 8.22E-07 | mr1067 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 5.69E-08 | 1.57E-07 | mr1069 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 3.66E-06 | NA | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 2.17E-08 | 2.61E-08 | mr1124 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 7.24E-06 | NA | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 4.14E-06 | 4.14E-06 | mr1200 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 2.49E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 2.47E-07 | 2.47E-07 | mr1795 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 4.17E-08 | 4.17E-08 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | 1.18E-07 | 1.18E-07 | mr1861 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 3.95E-06 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 2.60E-07 | mr1970 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 3.51E-10 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 1.41E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 3.39E-09 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 9.87E-12 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 4.33E-19 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 1.07E-08 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124176064 | NA | 6.20E-07 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |