\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124176064:

Variant ID: vg0124176064 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24176064
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGGCTCCTTAATTCCCAAATCATGGCTTTGTTCCCGGGTAAAAAGCACCATTCCAGTAGGTAAAAAATATTCTAAACTCTTAAGGGACATTCACTCCTT[G/A]
TTTCACTCCTTGTTTGTACGTCATCTAAATGATTATAATGAAACTTTAAAAAAATCAACAAAAGATATTAATATGTGATAAATCACTCTAGAAACATACA

Reverse complement sequence

TGTATGTTTCTAGAGTGATTTATCACATATTAATATCTTTTGTTGATTTTTTTAAAGTTTCATTATAATCATTTAGATGACGTACAAACAAGGAGTGAAA[C/T]
AAGGAGTGAATGTCCCTTAAGAGTTTAGAATATTTTTTACCTACTGGAATGGTGCTTTTTACCCGGGAACAAAGCCATGATTTGGGAATTAAGGAGCCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.50% 0.02% 0.36% NA
All Indica  2759 99.50% 0.00% 0.00% 0.51% NA
All Japonica  1512 95.20% 4.60% 0.07% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.00% 0.50% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.00% 0.00% 0.55% NA
Indica Intermediate  786 99.10% 0.10% 0.00% 0.76% NA
Temperate Japonica  767 91.10% 8.90% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.20% 0.60% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124176064 G -> A LOC_Os01g42510.1 upstream_gene_variant ; 4623.0bp to feature; MODIFIER silent_mutation Average:57.784; most accessible tissue: Callus, score: 76.703 N N N N
vg0124176064 G -> A LOC_Os01g42510.2 upstream_gene_variant ; 4623.0bp to feature; MODIFIER silent_mutation Average:57.784; most accessible tissue: Callus, score: 76.703 N N N N
vg0124176064 G -> A LOC_Os01g42510-LOC_Os01g42520 intergenic_region ; MODIFIER silent_mutation Average:57.784; most accessible tissue: Callus, score: 76.703 N N N N
vg0124176064 G -> DEL N N silent_mutation Average:57.784; most accessible tissue: Callus, score: 76.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124176064 8.22E-07 8.22E-07 mr1067 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 5.69E-08 1.57E-07 mr1069 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 3.66E-06 NA mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 2.17E-08 2.61E-08 mr1124 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 7.24E-06 NA mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 4.14E-06 4.14E-06 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 2.49E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 2.47E-07 2.47E-07 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 4.17E-08 4.17E-08 mr1855 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 1.18E-07 1.18E-07 mr1861 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 3.95E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 2.60E-07 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 3.51E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 1.41E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 3.39E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 9.87E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 4.33E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 1.07E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124176064 NA 6.20E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251