\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124173863:

Variant ID: vg0124173863 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24173863
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTAGGCTTTTGTTTGGTATATTCCACTTGCTTTGATATCTTAATATGGAGTGGTATCGGAGTATTAGCCGATACATGCTATATCTATCTGATCGGCT[A/G,T]
TGCTATGAACATATATAATCTTGTTGTTAATATATATTTCGATCTAAGTGATTTATACTATCTCGGCATGGCGACCGATCTAACTCAATCACTTGATTTA

Reverse complement sequence

TAAATCAAGTGATTGAGTTAGATCGGTCGCCATGCCGAGATAGTATAAATCACTTAGATCGAAATATATATTAACAACAAGATTATATATGTTCATAGCA[T/C,A]
AGCCGATCAGATAGATATAGCATGTATCGGCTAATACTCCGATACCACTCCATATTAAGATATCAAAGCAAGTGGAATATACCAAACAAAAGCCTAATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 35.10% 4.00% 3.81% T: 0.21%
All Indica  2759 30.10% 56.50% 6.67% 6.42% T: 0.36%
All Japonica  1512 95.00% 5.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 34.80% 60.00% 2.52% 2.02% T: 0.67%
Indica II  465 10.80% 80.20% 6.67% 2.37% NA
Indica III  913 36.70% 41.30% 10.30% 11.50% T: 0.22%
Indica Intermediate  786 30.30% 57.40% 5.60% 6.23% T: 0.51%
Temperate Japonica  767 91.10% 8.90% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 63.30% 27.80% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124173863 A -> G LOC_Os01g42510.1 upstream_gene_variant ; 2422.0bp to feature; MODIFIER silent_mutation Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0124173863 A -> G LOC_Os01g42510.2 upstream_gene_variant ; 2422.0bp to feature; MODIFIER silent_mutation Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0124173863 A -> G LOC_Os01g42510-LOC_Os01g42520 intergenic_region ; MODIFIER silent_mutation Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0124173863 A -> T LOC_Os01g42510.1 upstream_gene_variant ; 2422.0bp to feature; MODIFIER silent_mutation Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0124173863 A -> T LOC_Os01g42510.2 upstream_gene_variant ; 2422.0bp to feature; MODIFIER silent_mutation Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0124173863 A -> T LOC_Os01g42510-LOC_Os01g42520 intergenic_region ; MODIFIER silent_mutation Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 N N N N
vg0124173863 A -> DEL N N silent_mutation Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124173863 2.47E-06 2.47E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 4.29E-07 4.29E-07 mr1065 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 6.69E-09 6.69E-09 mr1067 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 2.89E-06 4.58E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 3.10E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 3.13E-06 NA mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 5.75E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 4.63E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 1.77E-08 3.32E-08 mr1124 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 3.19E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 2.43E-06 NA mr1183 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 6.37E-07 6.37E-07 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 1.72E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 8.41E-06 2.63E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 3.97E-06 mr1274 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 4.94E-06 4.20E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 2.77E-06 1.03E-06 mr1618 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 1.46E-06 6.83E-08 mr1619 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 1.03E-06 NA mr1629 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 6.59E-06 NA mr1789 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 5.99E-08 5.99E-08 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 6.22E-08 6.22E-08 mr1855 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 1.85E-07 1.85E-07 mr1861 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 4.63E-07 3.59E-08 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 2.28E-07 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 1.05E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 9.72E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 3.76E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 2.78E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 6.99E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 8.01E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 1.53E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 9.38E-06 NA mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124173863 NA 1.88E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251