| Variant ID: vg0124173863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24173863 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 245. )
ATATTAGGCTTTTGTTTGGTATATTCCACTTGCTTTGATATCTTAATATGGAGTGGTATCGGAGTATTAGCCGATACATGCTATATCTATCTGATCGGCT[A/G,T]
TGCTATGAACATATATAATCTTGTTGTTAATATATATTTCGATCTAAGTGATTTATACTATCTCGGCATGGCGACCGATCTAACTCAATCACTTGATTTA
TAAATCAAGTGATTGAGTTAGATCGGTCGCCATGCCGAGATAGTATAAATCACTTAGATCGAAATATATATTAACAACAAGATTATATATGTTCATAGCA[T/C,A]
AGCCGATCAGATAGATATAGCATGTATCGGCTAATACTCCGATACCACTCCATATTAAGATATCAAAGCAAGTGGAATATACCAAACAAAAGCCTAATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 35.10% | 4.00% | 3.81% | T: 0.21% |
| All Indica | 2759 | 30.10% | 56.50% | 6.67% | 6.42% | T: 0.36% |
| All Japonica | 1512 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 34.80% | 60.00% | 2.52% | 2.02% | T: 0.67% |
| Indica II | 465 | 10.80% | 80.20% | 6.67% | 2.37% | NA |
| Indica III | 913 | 36.70% | 41.30% | 10.30% | 11.50% | T: 0.22% |
| Indica Intermediate | 786 | 30.30% | 57.40% | 5.60% | 6.23% | T: 0.51% |
| Temperate Japonica | 767 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 27.80% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124173863 | A -> G | LOC_Os01g42510.1 | upstream_gene_variant ; 2422.0bp to feature; MODIFIER | silent_mutation | Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0124173863 | A -> G | LOC_Os01g42510.2 | upstream_gene_variant ; 2422.0bp to feature; MODIFIER | silent_mutation | Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0124173863 | A -> G | LOC_Os01g42510-LOC_Os01g42520 | intergenic_region ; MODIFIER | silent_mutation | Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0124173863 | A -> T | LOC_Os01g42510.1 | upstream_gene_variant ; 2422.0bp to feature; MODIFIER | silent_mutation | Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0124173863 | A -> T | LOC_Os01g42510.2 | upstream_gene_variant ; 2422.0bp to feature; MODIFIER | silent_mutation | Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0124173863 | A -> T | LOC_Os01g42510-LOC_Os01g42520 | intergenic_region ; MODIFIER | silent_mutation | Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| vg0124173863 | A -> DEL | N | N | silent_mutation | Average:41.386; most accessible tissue: Minghui63 flower, score: 60.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124173863 | 2.47E-06 | 2.47E-06 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | 4.29E-07 | 4.29E-07 | mr1065 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | 6.69E-09 | 6.69E-09 | mr1067 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | 2.89E-06 | 4.58E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | NA | 3.10E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | 3.13E-06 | NA | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | NA | 5.75E-06 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | NA | 4.63E-06 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | 1.77E-08 | 3.32E-08 | mr1124 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124173863 | NA | 3.19E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/