Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124133937:

Variant ID: vg0124133937 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24133937
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTTTAGAGCCCGAGGGAGTTGCAGATCCAAGCGAGGACCAAGAACCGCAAGACTTTGAGCAAGGCAAGTCATCACTATCCCTTGAACATGTTGATCC[T/C]
AATTGTGAAATTATTTCGTTTATAAATAAAATTACATGCAATGATGAACATCCTACTTGTGTTTATACCATGCCTTGATTATTGTTTACCCCTTATTCCT

Reverse complement sequence

AGGAATAAGGGGTAAACAATAATCAAGGCATGGTATAAACACAAGTAGGATGTTCATCATTGCATGTAATTTTATTTATAAACGAAATAATTTCACAATT[A/G]
GGATCAACATGTTCAAGGGATAGTGATGACTTGCCTTGCTCAAAGTCTTGCGGTTCTTGGTCCTCGCTTGGATCTGCAACTCCCTCGGGCTCTAAAATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.20%	28.10%	25.86%	15.87%	NA
All Indica	2759	50.40%	1.30%	26.21%	22.11%	NA
All Japonica	1512	0.50%	77.00%	14.09%	8.40%	NA
Aus	269	2.60%	2.20%	95.17%	0.00%	NA
Indica I	595	59.70%	1.50%	22.52%	16.30%	NA
Indica II	465	55.10%	0.90%	13.33%	30.75%	NA
Indica III	913	46.20%	1.40%	34.06%	18.29%	NA
Indica Intermediate	786	45.50%	1.10%	27.48%	25.83%	NA
Temperate Japonica	767	0.00%	89.80%	1.04%	9.13%	NA
Tropical Japonica	504	1.00%	53.20%	34.92%	10.91%	NA
Japonica Intermediate	241	1.20%	85.90%	12.03%	0.83%	NA
VI/Aromatic	96	1.00%	87.50%	10.42%	1.04%	NA
Intermediate	90	22.20%	42.20%	22.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124133937	T -> DEL	N	N	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 flower, score: 24.143	N	N	N	N
vg0124133937	T -> C	LOC_Os01g42440.1	upstream_gene_variant ; 3146.0bp to feature; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 flower, score: 24.143	N	N	N	N
vg0124133937	T -> C	LOC_Os01g42460.1	upstream_gene_variant ; 2934.0bp to feature; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 flower, score: 24.143	N	N	N	N
vg0124133937	T -> C	LOC_Os01g42430.1	downstream_gene_variant ; 4310.0bp to feature; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 flower, score: 24.143	N	N	N	N
vg0124133937	T -> C	LOC_Os01g42440-LOC_Os01g42460	intergenic_region ; MODIFIER	silent_mutation	Average:15.761; most accessible tissue: Zhenshan97 flower, score: 24.143	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124133937	NA	8.70E-40	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	3.51E-07	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	4.08E-06	2.74E-13	mr1188	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	6.52E-06	6.52E-06	mr1200	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	1.59E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	1.04E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	4.40E-18	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	1.89E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	7.98E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	1.02E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	6.12E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	5.01E-17	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	1.68E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	1.36E-19	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	3.08E-18	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	1.29E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124133937	NA	9.39E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251