\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124119893:

Variant ID: vg0124119893 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24119893
Reference Allele: TAlternative Allele: A,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


TTATATAATGCGAGTACACGTACACACGGCGTACTACGTGTTACCAGAAATGCTCCTGCATGCCCAAACCAAAAACTCACGTATATACAAATACACCCTG[T/A,C]
ATGGACAAACAGGTCAAGGCTTCCGTTGACCTGGTTAATTACGCTTAAGAATCCACTTAATTAGCTAATAATGACATGCACCCGCAGGTACTCTCCATAT

Reverse complement sequence

ATATGGAGAGTACCTGCGGGTGCATGTCATTATTAGCTAATTAAGTGGATTCTTAAGCGTAATTAACCAGGTCAACGGAAGCCTTGACCTGTTTGTCCAT[A/T,G]
CAGGGTGTATTTGTATATACGTGAGTTTTTGGTTTGGGCATGCAGGAGCATTTCTGGTAACACGTAGTACGCCGTGTGTACGTGTACTCGCATTATATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 25.50% 0.15% 0.00% C: 0.04%
All Indica  2759 99.50% 0.40% 0.04% 0.00% C: 0.07%
All Japonica  1512 28.60% 71.20% 0.26% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.17% 0.00% C: 0.17%
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.00% 0.00% C: 0.13%
Temperate Japonica  767 10.80% 88.90% 0.26% 0.00% NA
Tropical Japonica  504 55.00% 44.60% 0.40% 0.00% NA
Japonica Intermediate  241 29.90% 70.10% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124119893 T -> A LOC_Os01g42410.1 upstream_gene_variant ; 4750.0bp to feature; MODIFIER silent_mutation Average:65.707; most accessible tissue: Minghui63 root, score: 93.961 N N N N
vg0124119893 T -> A LOC_Os01g42420.1 downstream_gene_variant ; 3351.0bp to feature; MODIFIER silent_mutation Average:65.707; most accessible tissue: Minghui63 root, score: 93.961 N N N N
vg0124119893 T -> A LOC_Os01g42410-LOC_Os01g42420 intergenic_region ; MODIFIER silent_mutation Average:65.707; most accessible tissue: Minghui63 root, score: 93.961 N N N N
vg0124119893 T -> C LOC_Os01g42410.1 upstream_gene_variant ; 4750.0bp to feature; MODIFIER silent_mutation Average:65.707; most accessible tissue: Minghui63 root, score: 93.961 N N N N
vg0124119893 T -> C LOC_Os01g42420.1 downstream_gene_variant ; 3351.0bp to feature; MODIFIER silent_mutation Average:65.707; most accessible tissue: Minghui63 root, score: 93.961 N N N N
vg0124119893 T -> C LOC_Os01g42410-LOC_Os01g42420 intergenic_region ; MODIFIER silent_mutation Average:65.707; most accessible tissue: Minghui63 root, score: 93.961 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124119893 T A -0.01 -0.02 -0.01 -0.02 -0.01 -0.02
vg0124119893 T C -0.08 -0.06 -0.04 -0.01 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124119893 NA 3.93E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 NA 2.39E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 NA 1.67E-17 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 5.27E-06 5.27E-06 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 NA 4.24E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 7.52E-09 1.21E-19 mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 NA 9.55E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 5.90E-06 5.89E-06 mr1526 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 NA 1.52E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 NA 1.38E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 9.03E-07 9.03E-07 mr1945 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 3.85E-07 3.32E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 8.77E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 1.68E-07 2.93E-33 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124119893 7.17E-07 4.71E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251