\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124115850:

Variant ID: vg0124115850 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24115850
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGCTGCTCGGCTTGTTGTTTGCTGCGGTAGGTGACTGAATCGATTCGTGTGTATAGTGGCCATTTGGTTTATGTTAACCTTTGATTATTGGAAAAATT[A/G]
GAACCATACCATTATAATTTTGTAAAATTTGAGATATGCCATCCTGACCCACATGTCATTGACTTATGTGGGTCCTACATGTCATTGAGATACCGATGAC

Reverse complement sequence

GTCATCGGTATCTCAATGACATGTAGGACCCACATAAGTCAATGACATGTGGGTCAGGATGGCATATCTCAAATTTTACAAAATTATAATGGTATGGTTC[T/C]
AATTTTTCCAATAATCAAAGGTTAACATAAACCAAATGGCCACTATACACACGAATCGATTCAGTCACCTACCGCAGCAAACAACAAGCCGAGCAGCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 26.70% 1.21% 0.40% NA
All Indica  2759 96.60% 0.80% 1.92% 0.69% NA
All Japonica  1512 26.10% 73.70% 0.13% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 88.90% 0.70% 7.73% 2.69% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.70% 0.11% 0.11% NA
Indica Intermediate  786 97.60% 1.40% 0.76% 0.25% NA
Temperate Japonica  767 10.40% 89.40% 0.13% 0.00% NA
Tropical Japonica  504 49.20% 50.60% 0.20% 0.00% NA
Japonica Intermediate  241 27.80% 72.20% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124115850 A -> G LOC_Os01g42410.1 upstream_gene_variant ; 707.0bp to feature; MODIFIER silent_mutation Average:78.293; most accessible tissue: Minghui63 root, score: 98.827 N N N N
vg0124115850 A -> G LOC_Os01g42410-LOC_Os01g42420 intergenic_region ; MODIFIER silent_mutation Average:78.293; most accessible tissue: Minghui63 root, score: 98.827 N N N N
vg0124115850 A -> DEL N N silent_mutation Average:78.293; most accessible tissue: Minghui63 root, score: 98.827 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124115850 A G 0.01 -0.03 -0.04 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124115850 NA 7.86E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 3.30E-07 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 4.37E-07 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 6.34E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 4.44E-06 4.44E-06 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 8.41E-07 1.23E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 1.58E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 6.93E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 8.91E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 3.05E-06 NA mr1795 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 7.74E-06 mr1808 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 1.18E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 5.27E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 2.40E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 5.40E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 8.94E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 2.83E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 NA 9.18E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124115850 8.31E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251