\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124114468:

Variant ID: vg0124114468 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24114468
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCGGCGTCCGCGCGCGACGCCGCGGAGACCGTGGCCACGCTCACCTACCTCTGGTGTGTTTAGCCCACGCTAAAATTGAAAATTTGATTAAAATTGGAA[T/C]
GATATAACGAAAAAGTTAAAAGTTTGTATGTAAGAAAATTTTAATATAATGAAAAAAATTAAAAATTTGAAGAAAAAATTTGAAACTAAACTCGGCCTCT

Reverse complement sequence

AGAGGCCGAGTTTAGTTTCAAATTTTTTCTTCAAATTTTTAATTTTTTTCATTATATTAAAATTTTCTTACATACAAACTTTTAACTTTTTCGTTATATC[A/G]
TTCCAATTTTAATCAAATTTTCAATTTTAGCGTGGGCTAAACACACCAGAGGTAGGTGAGCGTGGCCACGGTCTCCGCGGCGTCGCGCGCGGACGCCGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 28.40% 10.56% 6.81% NA
All Indica  2759 71.70% 0.90% 15.80% 11.60% NA
All Japonica  1512 18.50% 78.70% 2.71% 0.13% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 66.40% 0.50% 20.34% 12.77% NA
Indica II  465 59.40% 0.20% 22.37% 18.06% NA
Indica III  913 83.00% 0.80% 10.08% 6.13% NA
Indica Intermediate  786 70.00% 1.70% 15.14% 13.23% NA
Temperate Japonica  767 9.80% 90.00% 0.26% 0.00% NA
Tropical Japonica  504 35.90% 56.70% 7.14% 0.20% NA
Japonica Intermediate  241 9.50% 88.80% 1.24% 0.41% NA
VI/Aromatic  96 3.10% 86.50% 10.42% 0.00% NA
Intermediate  90 45.60% 41.10% 13.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124114468 T -> DEL N N silent_mutation Average:95.409; most accessible tissue: Zhenshan97 young leaf, score: 98.362 N N N N
vg0124114468 T -> C LOC_Os01g42410.1 intron_variant ; MODIFIER silent_mutation Average:95.409; most accessible tissue: Zhenshan97 young leaf, score: 98.362 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124114468 T C 0.01 0.02 0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124114468 NA 3.27E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 4.29E-19 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 2.84E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 7.59E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 7.15E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 5.38E-07 1.34E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 1.19E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 3.22E-19 mr1933 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 1.97E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 3.77E-06 2.64E-29 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 2.56E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 1.65E-06 9.94E-35 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 4.75E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114468 NA 2.88E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251