\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124114465:

Variant ID: vg0124114465 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24114465
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GCTAGCGGCGTCCGCGCGCGACGCCGCGGAGACCGTGGCCACGCTCACCTACCTCTGGTGTGTTTAGCCCACGCTAAAATTGAAAATTTGATTAAAATTG[G/A]
AATGATATAACGAAAAAGTTAAAAGTTTGTATGTAAGAAAATTTTAATATAATGAAAAAAATTAAAAATTTGAAGAAAAAATTTGAAACTAAACTCGGCC

Reverse complement sequence

GGCCGAGTTTAGTTTCAAATTTTTTCTTCAAATTTTTAATTTTTTTCATTATATTAAAATTTTCTTACATACAAACTTTTAACTTTTTCGTTATATCATT[C/T]
CAATTTTAATCAAATTTTCAATTTTAGCGTGGGCTAAACACACCAGAGGTAGGTGAGCGTGGCCACGGTCTCCGCGGCGTCGCGCGCGGACGCCGCTAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 29.10% 4.06% 19.06% NA
All Indica  2759 19.10% 43.30% 5.58% 31.93% NA
All Japonica  1512 87.70% 10.00% 2.18% 0.13% NA
Aus  269 94.80% 0.70% 0.74% 3.72% NA
Indica I  595 24.90% 26.70% 5.55% 42.86% NA
Indica II  465 15.50% 36.60% 4.09% 43.87% NA
Indica III  913 12.60% 61.00% 7.67% 18.73% NA
Indica Intermediate  786 24.60% 39.40% 4.07% 31.93% NA
Temperate Japonica  767 90.20% 9.40% 0.39% 0.00% NA
Tropical Japonica  504 86.90% 7.10% 5.75% 0.20% NA
Japonica Intermediate  241 81.30% 17.80% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 62.20% 25.60% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124114465 G -> A LOC_Os01g42410.1 intron_variant ; MODIFIER silent_mutation Average:95.587; most accessible tissue: Zhenshan97 young leaf, score: 98.43 N N N N
vg0124114465 G -> DEL N N silent_mutation Average:95.587; most accessible tissue: Zhenshan97 young leaf, score: 98.43 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124114465 G A -0.03 -0.04 -0.04 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124114465 NA 6.08E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 2.53E-06 2.53E-06 mr1065 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 6.17E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 3.29E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 3.10E-06 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 2.21E-06 2.21E-06 mr1200 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 6.86E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 2.06E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 1.39E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 5.60E-06 5.60E-06 mr1861 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 1.52E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 1.11E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 2.78E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 6.35E-06 6.35E-06 mr1445_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 5.08E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 5.41E-06 5.41E-06 mr1655_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 1.08E-06 1.08E-06 mr1669_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 2.59E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124114465 NA 1.16E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251