\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124099244:

Variant ID: vg0124099244 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24099244
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AGACGAATCTTTTAATCCTAATTGCGCCATGATTTGACAATATGGTGCTACAGTAAACATTTGCTATTGATGAATTAATTAAGCTTAATAAATTTGTCTC[A/G]
TAATTTTCTAGTGAAATCAGTAATTTGTTTTATTATTAGACTACGTTTAATATTTTAAATATGTGTTCGTATATTCGATGTGACGGGCAAATTTTTTTTT

Reverse complement sequence

AAAAAAAAATTTGCCCGTCACATCGAATATACGAACACATATTTAAAATATTAAACGTAGTCTAATAATAAAACAAATTACTGATTTCACTAGAAAATTA[T/C]
GAGACAAATTTATTAAGCTTAATTAATTCATCAATAGCAAATGTTTACTGTAGCACCATATTGTCAAATCATGGCGCAATTAGGATTAAAAGATTCGTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 43.30% 0.34% 3.36% NA
All Indica  2759 42.60% 56.80% 0.29% 0.25% NA
All Japonica  1512 77.70% 12.00% 0.40% 9.85% NA
Aus  269 8.20% 91.80% 0.00% 0.00% NA
Indica I  595 62.40% 37.10% 0.50% 0.00% NA
Indica II  465 56.10% 43.00% 0.22% 0.65% NA
Indica III  913 22.70% 77.20% 0.11% 0.00% NA
Indica Intermediate  786 42.90% 56.20% 0.38% 0.51% NA
Temperate Japonica  767 89.30% 9.90% 0.39% 0.39% NA
Tropical Japonica  504 61.90% 10.90% 0.60% 26.59% NA
Japonica Intermediate  241 73.90% 21.20% 0.00% 4.98% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 53.30% 41.10% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124099244 A -> G LOC_Os01g42400.1 downstream_gene_variant ; 4105.0bp to feature; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 97.37 N N N N
vg0124099244 A -> G LOC_Os01g42380-LOC_Os01g42400 intergenic_region ; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 97.37 N N N N
vg0124099244 A -> DEL N N silent_mutation Average:94.585; most accessible tissue: Callus, score: 97.37 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124099244 A G 0.0 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124099244 7.35E-06 7.35E-06 mr1065 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 2.07E-07 NA mr1090 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 2.20E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 2.37E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 7.94E-06 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 2.05E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 3.32E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 5.11E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 1.76E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 7.44E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124099244 NA 2.35E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251