\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124060257:

Variant ID: vg0124060257 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24060257
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAAATTCGTTGCAATTAAATCTTCAAAACAAGACCATACATTGATATATTTCGATGAAAAAAAATTTAACTTATTATTGAATTATTTTTAAATGTTGC[G/A]
CGATGTTCCACCAGGTATATCGGAATTGTTTCACTAAGTAGATCGAAAATGTTTCACTCGTTTAAATCGGGTGTTGTTTCACCTTATATAAAAAGAATGT

Reverse complement sequence

ACATTCTTTTTATATAAGGTGAAACAACACCCGATTTAAACGAGTGAAACATTTTCGATCTACTTAGTGAAACAATTCCGATATACCTGGTGGAACATCG[C/T]
GCAACATTTAAAAATAATTCAATAATAAGTTAAATTTTTTTTCATCGAAATATATCAATGTATGGTCTTGTTTTGAAGATTTAATTGCAACGAATTTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 28.50% 6.20% 19.61% NA
All Indica  2759 57.10% 1.40% 8.41% 33.13% NA
All Japonica  1512 18.60% 78.10% 3.17% 0.13% NA
Aus  269 97.00% 2.20% 0.74% 0.00% NA
Indica I  595 72.90% 0.70% 0.67% 25.71% NA
Indica II  465 61.50% 0.00% 5.38% 33.12% NA
Indica III  913 44.00% 1.90% 15.44% 38.66% NA
Indica Intermediate  786 57.60% 2.20% 7.89% 32.32% NA
Temperate Japonica  767 1.70% 98.20% 0.00% 0.13% NA
Tropical Japonica  504 40.70% 50.20% 8.93% 0.20% NA
Japonica Intermediate  241 26.10% 72.60% 1.24% 0.00% NA
VI/Aromatic  96 11.50% 87.50% 0.00% 1.04% NA
Intermediate  90 36.70% 40.00% 12.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124060257 G -> A LOC_Os01g42350.1 upstream_gene_variant ; 4339.0bp to feature; MODIFIER silent_mutation Average:23.201; most accessible tissue: Callus, score: 79.094 N N N N
vg0124060257 G -> A LOC_Os01g42360.1 downstream_gene_variant ; 1005.0bp to feature; MODIFIER silent_mutation Average:23.201; most accessible tissue: Callus, score: 79.094 N N N N
vg0124060257 G -> A LOC_Os01g42370.1 downstream_gene_variant ; 4950.0bp to feature; MODIFIER silent_mutation Average:23.201; most accessible tissue: Callus, score: 79.094 N N N N
vg0124060257 G -> A LOC_Os01g42350-LOC_Os01g42360 intergenic_region ; MODIFIER silent_mutation Average:23.201; most accessible tissue: Callus, score: 79.094 N N N N
vg0124060257 G -> DEL N N silent_mutation Average:23.201; most accessible tissue: Callus, score: 79.094 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124060257 NA 4.79E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 1.35E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 1.51E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 6.41E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 2.22E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 2.90E-07 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 4.37E-06 5.32E-08 mr1787 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 8.94E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 3.09E-06 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 1.90E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 2.24E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060257 NA 1.41E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251