\
| Variant ID: vg0124060257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24060257 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 84. )
ATTAAATTCGTTGCAATTAAATCTTCAAAACAAGACCATACATTGATATATTTCGATGAAAAAAAATTTAACTTATTATTGAATTATTTTTAAATGTTGC[G/A]
CGATGTTCCACCAGGTATATCGGAATTGTTTCACTAAGTAGATCGAAAATGTTTCACTCGTTTAAATCGGGTGTTGTTTCACCTTATATAAAAAGAATGT
ACATTCTTTTTATATAAGGTGAAACAACACCCGATTTAAACGAGTGAAACATTTTCGATCTACTTAGTGAAACAATTCCGATATACCTGGTGGAACATCG[C/T]
GCAACATTTAAAAATAATTCAATAATAAGTTAAATTTTTTTTCATCGAAATATATCAATGTATGGTCTTGTTTTGAAGATTTAATTGCAACGAATTTAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.70% | 28.50% | 6.20% | 19.61% | NA |
| All Indica | 2759 | 57.10% | 1.40% | 8.41% | 33.13% | NA |
| All Japonica | 1512 | 18.60% | 78.10% | 3.17% | 0.13% | NA |
| Aus | 269 | 97.00% | 2.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 72.90% | 0.70% | 0.67% | 25.71% | NA |
| Indica II | 465 | 61.50% | 0.00% | 5.38% | 33.12% | NA |
| Indica III | 913 | 44.00% | 1.90% | 15.44% | 38.66% | NA |
| Indica Intermediate | 786 | 57.60% | 2.20% | 7.89% | 32.32% | NA |
| Temperate Japonica | 767 | 1.70% | 98.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 40.70% | 50.20% | 8.93% | 0.20% | NA |
| Japonica Intermediate | 241 | 26.10% | 72.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 87.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 36.70% | 40.00% | 12.22% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124060257 | G -> A | LOC_Os01g42350.1 | upstream_gene_variant ; 4339.0bp to feature; MODIFIER | silent_mutation | Average:23.201; most accessible tissue: Callus, score: 79.094 | N | N | N | N |
| vg0124060257 | G -> A | LOC_Os01g42360.1 | downstream_gene_variant ; 1005.0bp to feature; MODIFIER | silent_mutation | Average:23.201; most accessible tissue: Callus, score: 79.094 | N | N | N | N |
| vg0124060257 | G -> A | LOC_Os01g42370.1 | downstream_gene_variant ; 4950.0bp to feature; MODIFIER | silent_mutation | Average:23.201; most accessible tissue: Callus, score: 79.094 | N | N | N | N |
| vg0124060257 | G -> A | LOC_Os01g42350-LOC_Os01g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:23.201; most accessible tissue: Callus, score: 79.094 | N | N | N | N |
| vg0124060257 | G -> DEL | N | N | silent_mutation | Average:23.201; most accessible tissue: Callus, score: 79.094 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124060257 | NA | 4.79E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 1.35E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 1.51E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 6.41E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 2.22E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 2.90E-07 | mr1564 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | 4.37E-06 | 5.32E-08 | mr1787 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 8.94E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 3.09E-06 | mr1920 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 1.90E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 2.24E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060257 | NA | 1.41E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |