\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124060154:

Variant ID: vg0124060154 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24060154
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCGCTGACGTCAGCATGACGTCAGCGCCCAATTTACATGCAAAACTACTTTAAATTGATTTTTCTCTTAAATTACTTTCCAAATCATGATCCGATTAC[G/A]
CCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGACCATACATTGATATATTTCGATGAAAAAAAATTTAACTTATTATTGAATTATTTTTAAATGTT

Reverse complement sequence

AACATTTAAAAATAATTCAATAATAAGTTAAATTTTTTTTCATCGAAATATATCAATGTATGGTCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGG[C/T]
GTAATCGGATCATGATTTGGAAAGTAATTTAAGAGAAAAATCAATTTAAAGTAGTTTTGCATGTAAATTGGGCGCTGACGTCATGCTGACGTCAGCGCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.10% 26.90% 1.08% 43.97% NA
All Indica  2759 0.90% 24.20% 1.74% 73.18% NA
All Japonica  1512 78.00% 21.10% 0.13% 0.79% NA
Aus  269 1.90% 92.60% 0.00% 5.58% NA
Indica I  595 0.70% 11.60% 1.18% 86.55% NA
Indica II  465 0.20% 8.20% 3.87% 87.74% NA
Indica III  913 0.80% 41.50% 0.55% 57.17% NA
Indica Intermediate  786 1.50% 23.20% 2.29% 73.03% NA
Temperate Japonica  767 98.00% 1.20% 0.26% 0.52% NA
Tropical Japonica  504 50.20% 48.80% 0.00% 0.99% NA
Japonica Intermediate  241 72.20% 26.60% 0.00% 1.24% NA
VI/Aromatic  96 87.50% 10.40% 0.00% 2.08% NA
Intermediate  90 37.80% 27.80% 1.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124060154 G -> A LOC_Os01g42350.1 upstream_gene_variant ; 4236.0bp to feature; MODIFIER silent_mutation Average:30.234; most accessible tissue: Callus, score: 78.495 N N N N
vg0124060154 G -> A LOC_Os01g42360.1 downstream_gene_variant ; 1108.0bp to feature; MODIFIER silent_mutation Average:30.234; most accessible tissue: Callus, score: 78.495 N N N N
vg0124060154 G -> A LOC_Os01g42350-LOC_Os01g42360 intergenic_region ; MODIFIER silent_mutation Average:30.234; most accessible tissue: Callus, score: 78.495 N N N N
vg0124060154 G -> DEL N N silent_mutation Average:30.234; most accessible tissue: Callus, score: 78.495 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124060154 3.57E-07 NA mr1090 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154 4.64E-06 NA mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154 NA 4.23E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154 NA 3.16E-06 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154 NA 5.92E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154 NA 1.95E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124060154 NA 2.83E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251