\
| Variant ID: vg0124060154 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24060154 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 72. )
GGGCGCTGACGTCAGCATGACGTCAGCGCCCAATTTACATGCAAAACTACTTTAAATTGATTTTTCTCTTAAATTACTTTCCAAATCATGATCCGATTAC[G/A]
CCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGACCATACATTGATATATTTCGATGAAAAAAAATTTAACTTATTATTGAATTATTTTTAAATGTT
AACATTTAAAAATAATTCAATAATAAGTTAAATTTTTTTTCATCGAAATATATCAATGTATGGTCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGG[C/T]
GTAATCGGATCATGATTTGGAAAGTAATTTAAGAGAAAAATCAATTTAAAGTAGTTTTGCATGTAAATTGGGCGCTGACGTCATGCTGACGTCAGCGCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.10% | 26.90% | 1.08% | 43.97% | NA |
| All Indica | 2759 | 0.90% | 24.20% | 1.74% | 73.18% | NA |
| All Japonica | 1512 | 78.00% | 21.10% | 0.13% | 0.79% | NA |
| Aus | 269 | 1.90% | 92.60% | 0.00% | 5.58% | NA |
| Indica I | 595 | 0.70% | 11.60% | 1.18% | 86.55% | NA |
| Indica II | 465 | 0.20% | 8.20% | 3.87% | 87.74% | NA |
| Indica III | 913 | 0.80% | 41.50% | 0.55% | 57.17% | NA |
| Indica Intermediate | 786 | 1.50% | 23.20% | 2.29% | 73.03% | NA |
| Temperate Japonica | 767 | 98.00% | 1.20% | 0.26% | 0.52% | NA |
| Tropical Japonica | 504 | 50.20% | 48.80% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 72.20% | 26.60% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 87.50% | 10.40% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 37.80% | 27.80% | 1.11% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124060154 | G -> A | LOC_Os01g42350.1 | upstream_gene_variant ; 4236.0bp to feature; MODIFIER | silent_mutation | Average:30.234; most accessible tissue: Callus, score: 78.495 | N | N | N | N |
| vg0124060154 | G -> A | LOC_Os01g42360.1 | downstream_gene_variant ; 1108.0bp to feature; MODIFIER | silent_mutation | Average:30.234; most accessible tissue: Callus, score: 78.495 | N | N | N | N |
| vg0124060154 | G -> A | LOC_Os01g42350-LOC_Os01g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:30.234; most accessible tissue: Callus, score: 78.495 | N | N | N | N |
| vg0124060154 | G -> DEL | N | N | silent_mutation | Average:30.234; most accessible tissue: Callus, score: 78.495 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124060154 | 3.57E-07 | NA | mr1090 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060154 | 4.64E-06 | NA | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060154 | NA | 4.23E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060154 | NA | 3.16E-06 | mr1920 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060154 | NA | 5.92E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060154 | NA | 1.95E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124060154 | NA | 2.83E-08 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |