\
| Variant ID: vg0124058988 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24058988 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, C: 0.36, others allele: 0.00, population size: 104. )
ACGCATGTTTTCAGAGAAATTTTAAGAAAATATCATTGATAAGCATCCCATTACACGTTTTGCCATCGAGAAATACCAGTTTAAAAGTAAAAATATACCA[T/C]
CATAGAATGGATGGATTCTAACCACGATGACATTCTAGCACAATGTAGCTCGCACGATGATATTTTCTATAAGTTGCGTCTGTTGATGACATTTTTTCAA
TTGAAAAAATGTCATCAACAGACGCAACTTATAGAAAATATCATCGTGCGAGCTACATTGTGCTAGAATGTCATCGTGGTTAGAATCCATCCATTCTATG[A/G]
TGGTATATTTTTACTTTTAAACTGGTATTTCTCGATGGCAAAACGTGTAATGGGATGCTTATCAATGATATTTTCTTAAAATTTCTCTGAAAACATGCGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 44.90% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 42.50% | 57.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 36.00% | 64.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 35.70% | 63.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 48.60% | 51.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 44.30% | 55.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.30% | 38.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 41.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124058988 | T -> C | LOC_Os01g42350.1 | upstream_gene_variant ; 3070.0bp to feature; MODIFIER | silent_mutation | Average:42.406; most accessible tissue: Callus, score: 76.237 | N | N | N | N |
| vg0124058988 | T -> C | LOC_Os01g42360.1 | downstream_gene_variant ; 2274.0bp to feature; MODIFIER | silent_mutation | Average:42.406; most accessible tissue: Callus, score: 76.237 | N | N | N | N |
| vg0124058988 | T -> C | LOC_Os01g42350-LOC_Os01g42360 | intergenic_region ; MODIFIER | silent_mutation | Average:42.406; most accessible tissue: Callus, score: 76.237 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124058988 | NA | 2.79E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | 1.83E-06 | NA | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | 3.77E-07 | NA | mr1096 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 4.79E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 2.03E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 2.12E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 6.70E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 4.96E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 3.51E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 4.72E-14 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 1.88E-06 | mr1960 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 4.86E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 4.64E-07 | mr1495_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 4.19E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124058988 | NA | 8.69E-06 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |