\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124037134:

Variant ID: vg0124037134 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24037134
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGCATGTTCTAAAAGTCAAGGATGAATAATAACCGATTTTATAGTTTAGGGTGGAAGTAGACTTTGAGAAAGGTTCAAGGGCTAAAACTAGACTTTT[C/T]
CCTTTTTAAAAATCTAGGTTATGAGTTGAGAGACCAAAATTGATTACATTAAAACATATTTATATGGACTATTAAAGTAAGAAAGATTGTTATAAACCAC

Reverse complement sequence

GTGGTTTATAACAATCTTTCTTACTTTAATAGTCCATATAAATATGTTTTAATGTAATCAATTTTGGTCTCTCAACTCATAACCTAGATTTTTAAAAAGG[G/A]
AAAAGTCTAGTTTTAGCCCTTGAACCTTTCTCAAAGTCTACTTCCACCCTAAACTATAAAATCGGTTATTATTCATCCTTGACTTTTAGAACATGCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 25.90% 0.42% 4.80% NA
All Indica  2759 68.80% 30.20% 0.43% 0.62% NA
All Japonica  1512 79.40% 7.70% 0.00% 12.96% NA
Aus  269 2.60% 90.70% 2.97% 3.72% NA
Indica I  595 35.00% 64.20% 0.84% 0.00% NA
Indica II  465 93.80% 5.60% 0.00% 0.65% NA
Indica III  913 74.20% 25.30% 0.11% 0.44% NA
Indica Intermediate  786 73.30% 24.70% 0.76% 1.27% NA
Temperate Japonica  767 98.70% 0.90% 0.00% 0.39% NA
Tropical Japonica  504 52.40% 12.10% 0.00% 35.52% NA
Japonica Intermediate  241 74.30% 19.90% 0.00% 5.81% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 74.40% 21.10% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124037134 C -> T LOC_Os01g42340.1 upstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:29.439; most accessible tissue: Minghui63 root, score: 46.493 N N N N
vg0124037134 C -> T LOC_Os01g42330-LOC_Os01g42340 intergenic_region ; MODIFIER silent_mutation Average:29.439; most accessible tissue: Minghui63 root, score: 46.493 N N N N
vg0124037134 C -> DEL N N silent_mutation Average:29.439; most accessible tissue: Minghui63 root, score: 46.493 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124037134 NA 8.52E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 3.95E-06 3.95E-06 mr1877 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 7.92E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.91E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 3.44E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.06E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 4.74E-09 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 3.15E-08 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 2.76E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 2.00E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.54E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 6.32E-09 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.00E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 2.39E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 5.85E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.99E-08 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 3.09E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.69E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.21E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 2.02E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 5.78E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124037134 NA 1.42E-06 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251