Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124036172:

Variant ID: vg0124036172 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24036172
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, G: 0.20, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GTCGCTGCCCGCTTCCGCCCACGTGGATTCGGAGGAGGAGAGGAGAGAGAACGAGAGGAGAGGATAGGAGAGAAAGAGAGTAGAGGGGAGAAATATCAGA[T/G]
AGGGAAAGAGACGGGTGAAAAATTTTAAAGGGTTGAGAAGGGAAACAGAGAGTAGGAGAGAAAAAAAAGAGGGGGTATTTTTGCAAGCGGACAACTTAAG

Reverse complement sequence

CTTAAGTTGTCCGCTTGCAAAAATACCCCCTCTTTTTTTTCTCTCCTACTCTCTGTTTCCCTTCTCAACCCTTTAAAATTTTTCACCCGTCTCTTTCCCT[A/C]
TCTGATATTTCTCCCCTCTACTCTCTTTCTCTCCTATCCTCTCCTCTCGTTCTCTCTCCTCTCCTCCTCCGAATCCACGTGGGCGGAAGCGGGCAGCGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	28.30%	0.15%	4.34%	NA
All Indica	2759	68.00%	31.60%	0.14%	0.25%	NA
All Japonica	1512	78.00%	9.00%	0.13%	12.83%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	32.90%	66.90%	0.17%	0.00%	NA
Indica II	465	93.50%	5.60%	0.22%	0.65%	NA
Indica III	913	74.20%	25.60%	0.11%	0.11%	NA
Indica Intermediate	786	72.40%	27.10%	0.13%	0.38%	NA
Temperate Japonica	767	98.30%	1.30%	0.00%	0.39%	NA
Tropical Japonica	504	52.20%	12.30%	0.40%	35.12%	NA
Japonica Intermediate	241	67.60%	26.60%	0.00%	5.81%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	22.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124036172	T -> G	LOC_Os01g42340.1	upstream_gene_variant ; 1915.0bp to feature; MODIFIER	silent_mutation	Average:56.711; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0124036172	T -> G	LOC_Os01g42330-LOC_Os01g42340	intergenic_region ; MODIFIER	silent_mutation	Average:56.711; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N
vg0124036172	T -> DEL	N	N	silent_mutation	Average:56.711; most accessible tissue: Zhenshan97 panicle, score: 75.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124036172	NA	5.97E-18	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124036172	NA	2.36E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.43E-07	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	7.87E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.88E-10	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.29E-08	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.70E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	2.09E-07	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.20E-06	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	4.82E-11	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.40E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	4.16E-08	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	5.36E-11	mr1360_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.61E-09	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.13E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	5.09E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	4.41E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.60E-08	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.68E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	3.28E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	7.57E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	6.46E-09	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	2.63E-17	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	7.30E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.14E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.14E-06	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.07E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	4.07E-06	mr1994_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124036172	NA	1.38E-06	mr1994_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251