\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124035433:

Variant ID: vg0124035433 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24035433
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAGATCTGTCTTTCAAAGCACTATAATATATATAATATATAAAAGTAAACATATATTTATTTATTGTATATATTATAATAGAAATATAATGTCAAAG[G/A]
TATATTTTGTAGACCGTGTCGTTGTCCAAAACGTCAATTAAAATAAAACCGGAGGAAATACCATATAACGTACATAGAACTCTGCACTGACACATGAATT

Reverse complement sequence

AATTCATGTGTCAGTGCAGAGTTCTATGTACGTTATATGGTATTTCCTCCGGTTTTATTTTAATTGACGTTTTGGACAACGACACGGTCTACAAAATATA[C/T]
CTTTGACATTATATTTCTATTATAATATATACAATAAATAAATATATGTTTACTTTTATATATTATATATATTATAGTGCTTTGAAAGACAGATCTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 24.70% 3.15% 4.38% NA
All Indica  2759 68.70% 25.90% 5.11% 0.29% NA
All Japonica  1512 78.20% 8.70% 0.20% 12.90% NA
Aus  269 2.60% 97.00% 0.37% 0.00% NA
Indica I  595 34.50% 54.10% 11.43% 0.00% NA
Indica II  465 94.00% 3.70% 1.72% 0.65% NA
Indica III  913 74.30% 21.20% 4.38% 0.11% NA
Indica Intermediate  786 73.20% 23.20% 3.18% 0.51% NA
Temperate Japonica  767 98.60% 0.90% 0.13% 0.39% NA
Tropical Japonica  504 52.20% 12.10% 0.40% 35.32% NA
Japonica Intermediate  241 68.00% 26.10% 0.00% 5.81% NA
VI/Aromatic  96 52.10% 45.80% 2.08% 0.00% NA
Intermediate  90 73.30% 20.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124035433 G -> A LOC_Os01g42340.1 upstream_gene_variant ; 2654.0bp to feature; MODIFIER silent_mutation Average:34.742; most accessible tissue: Callus, score: 65.406 N N N N
vg0124035433 G -> A LOC_Os01g42330-LOC_Os01g42340 intergenic_region ; MODIFIER silent_mutation Average:34.742; most accessible tissue: Callus, score: 65.406 N N N N
vg0124035433 G -> DEL N N silent_mutation Average:34.742; most accessible tissue: Callus, score: 65.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124035433 NA 7.81E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124035433 NA 2.26E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 6.46E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 9.83E-09 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 3.81E-08 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 7.74E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 3.34E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 1.54E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 9.25E-11 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 7.98E-10 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 2.36E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 7.85E-11 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 9.42E-10 mr1360_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 6.97E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 6.48E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 1.10E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 7.87E-08 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 3.17E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 1.27E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 4.47E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 1.58E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 1.05E-16 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 2.57E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 2.76E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 3.71E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 4.91E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 2.14E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433 NA 6.60E-07 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251