Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124035433:

Variant ID: vg0124035433 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24035433
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ATATAGATCTGTCTTTCAAAGCACTATAATATATATAATATATAAAAGTAAACATATATTTATTTATTGTATATATTATAATAGAAATATAATGTCAAAG[G/A]
TATATTTTGTAGACCGTGTCGTTGTCCAAAACGTCAATTAAAATAAAACCGGAGGAAATACCATATAACGTACATAGAACTCTGCACTGACACATGAATT

Reverse complement sequence

AATTCATGTGTCAGTGCAGAGTTCTATGTACGTTATATGGTATTTCCTCCGGTTTTATTTTAATTGACGTTTTGGACAACGACACGGTCTACAAAATATA[C/T]
CTTTGACATTATATTTCTATTATAATATATACAATAAATAAATATATGTTTACTTTTATATATTATATATATTATAGTGCTTTGAAAGACAGATCTATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	24.70%	3.15%	4.38%	NA
All Indica	2759	68.70%	25.90%	5.11%	0.29%	NA
All Japonica	1512	78.20%	8.70%	0.20%	12.90%	NA
Aus	269	2.60%	97.00%	0.37%	0.00%	NA
Indica I	595	34.50%	54.10%	11.43%	0.00%	NA
Indica II	465	94.00%	3.70%	1.72%	0.65%	NA
Indica III	913	74.30%	21.20%	4.38%	0.11%	NA
Indica Intermediate	786	73.20%	23.20%	3.18%	0.51%	NA
Temperate Japonica	767	98.60%	0.90%	0.13%	0.39%	NA
Tropical Japonica	504	52.20%	12.10%	0.40%	35.32%	NA
Japonica Intermediate	241	68.00%	26.10%	0.00%	5.81%	NA
VI/Aromatic	96	52.10%	45.80%	2.08%	0.00%	NA
Intermediate	90	73.30%	20.00%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124035433	G -> A	LOC_Os01g42340.1	upstream_gene_variant ; 2654.0bp to feature; MODIFIER	silent_mutation	Average:34.742; most accessible tissue: Callus, score: 65.406	N	N	N	N
vg0124035433	G -> A	LOC_Os01g42330-LOC_Os01g42340	intergenic_region ; MODIFIER	silent_mutation	Average:34.742; most accessible tissue: Callus, score: 65.406	N	N	N	N
vg0124035433	G -> DEL	N	N	silent_mutation	Average:34.742; most accessible tissue: Callus, score: 65.406	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124035433	NA	7.81E-18	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0124035433	NA	2.26E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	6.46E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	9.83E-09	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	3.81E-08	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	7.74E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	3.34E-07	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	1.54E-06	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	9.25E-11	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	7.98E-10	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	2.36E-08	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	7.85E-11	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	9.42E-10	mr1360_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	6.97E-10	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	6.48E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	1.10E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	7.87E-08	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	3.17E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	1.27E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	4.47E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	1.58E-08	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	1.05E-16	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	2.57E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	2.76E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	3.71E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	4.91E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	2.14E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124035433	NA	6.60E-07	mr1994_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251