Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124031212:

Variant ID: vg0124031212 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24031212
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATGAGTAATTTAAGAGAAAATTTTATTTGAAGCATAGATGATAGGAATATTTCCCCTACTTACTCAATGGATTAATAGCAACCAAAACTCCTAGAGTA[A/C]
TAGCACGTGGATGTCTCTGATTAAGACTAATTGGAGAGGCCTCTTCAATTAGATTTACCGATTCCTTGGCCACCTTTCTCTGTCCGACCCTTCTTTAGAA

Reverse complement sequence

TTCTAAAGAAGGGTCGGACAGAGAAAGGTGGCCAAGGAATCGGTAAATCTAATTGAAGAGGCCTCTCCAATTAGTCTTAATCAGAGACATCCACGTGCTA[T/G]
TACTCTAGGAGTTTTGGTTGCTATTAATCCATTGAGTAAGTAGGGGAAATATTCCTATCATCTATGCTTCAAATAAAATTTTCTCTTAAATTACTCATTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	25.10%	0.02%	4.38%	NA
All Indica	2759	63.60%	36.10%	0.04%	0.29%	NA
All Japonica	1512	78.50%	8.50%	0.00%	12.96%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	87.90%	12.10%	0.00%	0.00%	NA
Indica II	465	67.30%	32.00%	0.00%	0.65%	NA
Indica III	913	48.70%	51.20%	0.00%	0.11%	NA
Indica Intermediate	786	60.30%	39.10%	0.13%	0.51%	NA
Temperate Japonica	767	98.60%	1.00%	0.00%	0.39%	NA
Tropical Japonica	504	52.20%	12.30%	0.00%	35.52%	NA
Japonica Intermediate	241	69.70%	24.50%	0.00%	5.81%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	66.70%	30.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124031212	A -> DEL	N	N	silent_mutation	Average:29.721; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0124031212	A -> C	LOC_Os01g42330.1	upstream_gene_variant ; 3677.0bp to feature; MODIFIER	silent_mutation	Average:29.721; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0124031212	A -> C	LOC_Os01g42330-LOC_Os01g42340	intergenic_region ; MODIFIER	silent_mutation	Average:29.721; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124031212	NA	2.96E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	4.84E-07	mr1428	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	3.97E-08	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	1.57E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	5.06E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	8.46E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	3.28E-07	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	6.70E-07	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124031212	NA	6.40E-07	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251