\
| Variant ID: vg0124008913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24008913 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 92. )
CGAGGCAACGCCAAGTCCTCTCTTGCAATGTCACAAATCACCAAACTCAGCAAGAAGTTGACATAGTACGTACTCCCTCCGTATTCGTATTTTAATTTAT[G/A]
ACGCCGTTGACTTTTTATCAATTTTTATCCTTCGTTTTATTTAAAATTTTTATGTAAATATGAAAATATTTATATCATACTTAAAGAATATTTGATGATG
CATCATCAAATATTCTTTAAGTATGATATAAATATTTTCATATTTACATAAAAATTTTAAATAAAACGAAGGATAAAAATTGATAAAAAGTCAACGGCGT[C/T]
ATAAATTAAAATACGAATACGGAGGGAGTACGTACTATGTCAACTTCTTGCTGAGTTTGGTGATTTGTGACATTGCAAGAGAGGACTTGGCGTTGCCTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 41.80% | 0.11% | 4.38% | NA |
| All Indica | 2759 | 33.80% | 65.80% | 0.11% | 0.29% | NA |
| All Japonica | 1512 | 78.40% | 8.50% | 0.13% | 12.90% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.20% | 38.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 12.90% | 86.50% | 0.00% | 0.65% | NA |
| Indica III | 913 | 29.90% | 69.90% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 30.00% | 69.30% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 87.40% | 12.10% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 59.10% | 5.60% | 0.00% | 35.32% | NA |
| Japonica Intermediate | 241 | 90.50% | 3.30% | 0.41% | 5.81% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 33.30% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124008913 | G -> A | LOC_Os01g42310-LOC_Os01g42320 | intergenic_region ; MODIFIER | silent_mutation | Average:44.674; most accessible tissue: Zhenshan97 root, score: 82.361 | N | N | N | N |
| vg0124008913 | G -> DEL | N | N | silent_mutation | Average:44.674; most accessible tissue: Zhenshan97 root, score: 82.361 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124008913 | NA | 2.35E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | 1.27E-06 | 1.27E-06 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 4.08E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 1.27E-08 | mr1652 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 9.52E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 1.59E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 1.09E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 3.13E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 1.40E-09 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 3.33E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124008913 | NA | 2.10E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |