\
| Variant ID: vg0123966864 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23966864 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 236. )
AGATTAATATGATATTTTAGAGCAACTTTCATATAAAAAGTTTTCACATGAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCCACGAAAATCTTAATCTT[C/T]
ATTCAACTCTTGTTGGAGAAAAGAACGAGACCTTAAGTATAGGTAAAACTTCCCCATCATGAGAATTATCTCGAAAACAAAGTATGATCATACTAAATTT
AAATTTAGTATGATCATACTTTGTTTTCGAGATAATTCTCATGATGGGGAAGTTTTACCTATACTTAAGGTCTCGTTCTTTTCTCCAACAAGAGTTGAAT[G/A]
AAGATTAAGATTTTCGTGGCACGCTTTTCAAACTGCTAAACGGTGCGTTTCATGTGAAAACTTTTTATATGAAAGTTGCTCTAAAATATCATATTAATCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.90% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 5.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 8.60% | 90.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.50% | 9.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 7.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123966864 | C -> T | LOC_Os01g42270.1 | upstream_gene_variant ; 3409.0bp to feature; MODIFIER | silent_mutation | Average:31.335; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0123966864 | C -> T | LOC_Os01g42280.1 | upstream_gene_variant ; 2893.0bp to feature; MODIFIER | silent_mutation | Average:31.335; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0123966864 | C -> T | LOC_Os01g42270-LOC_Os01g42280 | intergenic_region ; MODIFIER | silent_mutation | Average:31.335; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123966864 | NA | 5.65E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123966864 | NA | 8.77E-24 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123966864 | NA | 4.42E-23 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123966864 | 1.46E-06 | NA | mr1348_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123966864 | NA | 9.29E-16 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123966864 | NA | 9.29E-12 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123966864 | NA | 3.01E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |