Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123966864:

Variant ID: vg0123966864 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23966864
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGATTAATATGATATTTTAGAGCAACTTTCATATAAAAAGTTTTCACATGAAACGCACCGTTTAGCAGTTTGAAAAGCGTGCCACGAAAATCTTAATCTT[C/T]
ATTCAACTCTTGTTGGAGAAAAGAACGAGACCTTAAGTATAGGTAAAACTTCCCCATCATGAGAATTATCTCGAAAACAAAGTATGATCATACTAAATTT

Reverse complement sequence

AAATTTAGTATGATCATACTTTGTTTTCGAGATAATTCTCATGATGGGGAAGTTTTACCTATACTTAAGGTCTCGTTCTTTTCTCCAACAAGAGTTGAAT[G/A]
AAGATTAAGATTTTCGTGGCACGCTTTTCAAACTGCTAAACGGTGCGTTTCATGTGAAAACTTTTTATATGAAAGTTGCTCTAAAATATCATATTAATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.90% 0.11% 0.00% NA
All Indica  2759 94.20% 5.70% 0.11% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 8.60% 90.70% 0.74% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 90.50% 9.40% 0.11% 0.00% NA
Indica Intermediate  786 92.40% 7.40% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123966864 C -> T LOC_Os01g42270.1 upstream_gene_variant ; 3409.0bp to feature; MODIFIER silent_mutation Average:31.335; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0123966864 C -> T LOC_Os01g42280.1 upstream_gene_variant ; 2893.0bp to feature; MODIFIER silent_mutation Average:31.335; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0123966864 C -> T LOC_Os01g42270-LOC_Os01g42280 intergenic_region ; MODIFIER silent_mutation Average:31.335; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123966864 NA 5.65E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123966864 NA 8.77E-24 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123966864 NA 4.42E-23 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123966864 1.46E-06 NA mr1348_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123966864 NA 9.29E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123966864 NA 9.29E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123966864 NA 3.01E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251