Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123891450:

Variant ID: vg0123891450 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23891450
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAACGTCTCTTAACCACAAAATCAGAAATCTTCACCCCTAAACTATATAAAACCTTCAAAATAGGTCCCAAGGCAGTATAGTGGGCTGGTTTCACTAA[C/T]
GTGGCATTCTAGTCAGCACAAATAATAAAAATAAATATATGGAGCCCAGATGTAAGTGACCCACATTTTTCTGTTGTTCTCTTTTTCTCTCCGGGCGCGG

Reverse complement sequence

CCGCGCCCGGAGAGAAAAAGAGAACAACAGAAAAATGTGGGTCACTTACATCTGGGCTCCATATATTTATTTTTATTATTTGTGCTGACTAGAATGCCAC[G/A]
TTAGTGAAACCAGCCCACTATACTGCCTTGGGACCTATTTTGAAGGTTTTATATAGTTTAGGGGTGAAGATTTCTGATTTTGTGGTTAAGAGACGTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	17.10%	0.32%	5.27%	NA
All Indica	2759	84.30%	14.40%	0.11%	1.16%	NA
All Japonica	1512	61.60%	23.90%	0.46%	14.02%	NA
Aus	269	98.50%	0.00%	1.49%	0.00%	NA
Indica I	595	95.60%	2.40%	0.17%	1.85%	NA
Indica II	465	95.90%	2.60%	0.00%	1.51%	NA
Indica III	913	73.80%	26.10%	0.00%	0.11%	NA
Indica Intermediate	786	81.20%	16.90%	0.25%	1.65%	NA
Temperate Japonica	767	91.10%	0.70%	0.52%	7.69%	NA
Tropical Japonica	504	16.70%	54.80%	0.20%	28.37%	NA
Japonica Intermediate	241	61.80%	33.20%	0.83%	4.15%	NA
VI/Aromatic	96	60.40%	38.50%	1.04%	0.00%	NA
Intermediate	90	82.20%	12.20%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123891450	C -> T	LOC_Os01g42140.1	upstream_gene_variant ; 3228.0bp to feature; MODIFIER	silent_mutation	Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0123891450	C -> T	LOC_Os01g42150.1	upstream_gene_variant ; 739.0bp to feature; MODIFIER	silent_mutation	Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0123891450	C -> T	LOC_Os01g42140.2	upstream_gene_variant ; 3263.0bp to feature; MODIFIER	silent_mutation	Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0123891450	C -> T	LOC_Os01g42150-LOC_Os01g42160	intergenic_region ; MODIFIER	silent_mutation	Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N
vg0123891450	C -> DEL	N	N	silent_mutation	Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123891450	NA	1.77E-06	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	6.42E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	3.21E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	4.18E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.18E-07	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.33E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	2.85E-10	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	5.04E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	2.96E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	3.37E-11	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	5.57E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	9.42E-06	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	7.96E-09	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.09E-07	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	6.81E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	4.25E-06	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	7.83E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	2.01E-11	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.52E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	5.16E-10	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	5.60E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	6.17E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	9.62E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.64E-06	mr1312_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	5.13E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	7.15E-07	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.95E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	4.06E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	3.21E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	3.44E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	2.90E-06	1.68E-06	mr1663_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	5.84E-06	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.65E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	2.75E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	7.69E-10	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	2.24E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	4.79E-06	mr1816_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	2.05E-06	mr1832_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	1.27E-06	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	7.74E-06	7.74E-06	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450	NA	3.03E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251