\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123891450:

Variant ID: vg0123891450 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23891450
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAACGTCTCTTAACCACAAAATCAGAAATCTTCACCCCTAAACTATATAAAACCTTCAAAATAGGTCCCAAGGCAGTATAGTGGGCTGGTTTCACTAA[C/T]
GTGGCATTCTAGTCAGCACAAATAATAAAAATAAATATATGGAGCCCAGATGTAAGTGACCCACATTTTTCTGTTGTTCTCTTTTTCTCTCCGGGCGCGG

Reverse complement sequence

CCGCGCCCGGAGAGAAAAAGAGAACAACAGAAAAATGTGGGTCACTTACATCTGGGCTCCATATATTTATTTTTATTATTTGTGCTGACTAGAATGCCAC[G/A]
TTAGTGAAACCAGCCCACTATACTGCCTTGGGACCTATTTTGAAGGTTTTATATAGTTTAGGGGTGAAGATTTCTGATTTTGTGGTTAAGAGACGTTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 17.10% 0.32% 5.27% NA
All Indica  2759 84.30% 14.40% 0.11% 1.16% NA
All Japonica  1512 61.60% 23.90% 0.46% 14.02% NA
Aus  269 98.50% 0.00% 1.49% 0.00% NA
Indica I  595 95.60% 2.40% 0.17% 1.85% NA
Indica II  465 95.90% 2.60% 0.00% 1.51% NA
Indica III  913 73.80% 26.10% 0.00% 0.11% NA
Indica Intermediate  786 81.20% 16.90% 0.25% 1.65% NA
Temperate Japonica  767 91.10% 0.70% 0.52% 7.69% NA
Tropical Japonica  504 16.70% 54.80% 0.20% 28.37% NA
Japonica Intermediate  241 61.80% 33.20% 0.83% 4.15% NA
VI/Aromatic  96 60.40% 38.50% 1.04% 0.00% NA
Intermediate  90 82.20% 12.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123891450 C -> T LOC_Os01g42140.1 upstream_gene_variant ; 3228.0bp to feature; MODIFIER silent_mutation Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0123891450 C -> T LOC_Os01g42150.1 upstream_gene_variant ; 739.0bp to feature; MODIFIER silent_mutation Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0123891450 C -> T LOC_Os01g42140.2 upstream_gene_variant ; 3263.0bp to feature; MODIFIER silent_mutation Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0123891450 C -> T LOC_Os01g42150-LOC_Os01g42160 intergenic_region ; MODIFIER silent_mutation Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0123891450 C -> DEL N N silent_mutation Average:75.93; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123891450 NA 1.77E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 6.42E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 3.21E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 4.18E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.18E-07 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.33E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 2.85E-10 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 5.04E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 2.96E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 3.37E-11 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 5.57E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 9.42E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 7.96E-09 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.09E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 6.81E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 4.25E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 7.83E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 2.01E-11 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.52E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 5.16E-10 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 5.60E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 6.17E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 9.62E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.64E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 5.13E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 7.15E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.95E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 4.06E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 3.21E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 3.44E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 2.90E-06 1.68E-06 mr1663_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 5.84E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.65E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 2.75E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 7.69E-10 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 2.24E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 4.79E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 2.05E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 1.27E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 7.74E-06 7.74E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123891450 NA 3.03E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251