\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123888552:

Variant ID: vg0123888552 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23888552
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTAAAAGCAAATGCTAAAAAAATAAACTTTGATTAAAAAAACTTAAAACCAACTATAAATTTAAGGTAAAAAATTAAATTTTGGTTGATAAGCATAAG[T/C]
ATAAGCGAAAAGATGAAGTTGTCAATCAGATAACAAAGTGTTTGACATTTGAGGCCTGAGGAACTTTGGATGTGCTCTAAATTTTCGCTGTAGAGCAAGT

Reverse complement sequence

ACTTGCTCTACAGCGAAAATTTAGAGCACATCCAAAGTTCCTCAGGCCTCAAATGTCAAACACTTTGTTATCTGATTGACAACTTCATCTTTTCGCTTAT[A/G]
CTTATGCTTATCAACCAAAATTTAATTTTTTACCTTAAATTTATAGTTGGTTTTAAGTTTTTTTAATCAAAGTTTATTTTTTTAGCATTTGCTTTTAGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 32.10% 0.02% 0.00% NA
All Indica  2759 70.30% 29.60% 0.04% 0.00% NA
All Japonica  1512 75.40% 24.60% 0.00% 0.00% NA
Aus  269 6.70% 93.30% 0.00% 0.00% NA
Indica I  595 92.30% 7.70% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 45.70% 54.20% 0.11% 0.00% NA
Indica Intermediate  786 68.60% 31.40% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 45.60% 54.40% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.50% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123888552 T -> C LOC_Os01g42130.1 upstream_gene_variant ; 2827.0bp to feature; MODIFIER silent_mutation Average:93.622; most accessible tissue: Callus, score: 98.308 N N N N
vg0123888552 T -> C LOC_Os01g42140.1 upstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:93.622; most accessible tissue: Callus, score: 98.308 N N N N
vg0123888552 T -> C LOC_Os01g42140.2 upstream_gene_variant ; 365.0bp to feature; MODIFIER silent_mutation Average:93.622; most accessible tissue: Callus, score: 98.308 N N N N
vg0123888552 T -> C LOC_Os01g42120.1 downstream_gene_variant ; 4346.0bp to feature; MODIFIER silent_mutation Average:93.622; most accessible tissue: Callus, score: 98.308 N N N N
vg0123888552 T -> C LOC_Os01g42150.1 downstream_gene_variant ; 1573.0bp to feature; MODIFIER silent_mutation Average:93.622; most accessible tissue: Callus, score: 98.308 N N N N
vg0123888552 T -> C LOC_Os01g42140-LOC_Os01g42150 intergenic_region ; MODIFIER silent_mutation Average:93.622; most accessible tissue: Callus, score: 98.308 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123888552 T C -0.02 -0.02 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123888552 NA 6.72E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 1.76E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 6.20E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 4.32E-07 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 8.84E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 2.50E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 3.56E-09 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 1.80E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 5.03E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 9.24E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 3.54E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 6.84E-09 mr1125_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 1.29E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 4.75E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 2.68E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 1.20E-08 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 1.96E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 3.59E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 7.06E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 2.85E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 3.09E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 1.08E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123888552 NA 3.43E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251