\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123863533:

Variant ID: vg0123863533 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23863533
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATTCTCACATTAATCAGAGAAAAAGAAAAAGCAGAGTCCATATAGAAATACAATTTAGAAATAGCTGAAATTTAGAATTAAAAAATAAGGAATATTA[G/A]
AAGAGGAGACTAGAGTAGTTATTACACATTAGTAGTTTTGAAAAGTTATTGCAAAATTTAAAATTATGTTGTCATTGTAATATATTTTAATAATATAATG

Reverse complement sequence

CATTATATTATTAAAATATATTACAATGACAACATAATTTTAAATTTTGCAATAACTTTTCAAAACTACTAATGTGTAATAACTACTCTAGTCTCCTCTT[C/T]
TAATATTCCTTATTTTTTAATTCTAAATTTCAGCTATTTCTAAATTGTATTTCTATATGGACTCTGCTTTTTCTTTTTCTCTGATTAATGTGAGAATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 5.40% 8.82% 37.88% NA
All Indica  2759 44.60% 1.30% 11.13% 42.95% NA
All Japonica  1512 60.60% 14.00% 2.78% 22.62% NA
Aus  269 5.20% 0.00% 21.93% 72.86% NA
Indica I  595 30.60% 1.80% 5.55% 62.02% NA
Indica II  465 83.00% 1.50% 1.08% 14.41% NA
Indica III  913 30.70% 0.10% 23.66% 45.56% NA
Indica Intermediate  786 48.70% 2.20% 6.74% 42.37% NA
Temperate Japonica  767 90.10% 6.10% 2.61% 1.17% NA
Tropical Japonica  504 16.30% 31.20% 2.98% 49.60% NA
Japonica Intermediate  241 59.30% 3.30% 2.90% 34.44% NA
VI/Aromatic  96 50.00% 0.00% 3.12% 46.88% NA
Intermediate  90 61.10% 7.80% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123863533 G -> A LOC_Os01g42090.1 upstream_gene_variant ; 1148.0bp to feature; MODIFIER silent_mutation Average:30.302; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0123863533 G -> A LOC_Os01g42080.1 downstream_gene_variant ; 1693.0bp to feature; MODIFIER silent_mutation Average:30.302; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0123863533 G -> A LOC_Os01g42080-LOC_Os01g42090 intergenic_region ; MODIFIER silent_mutation Average:30.302; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0123863533 G -> DEL N N silent_mutation Average:30.302; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123863533 NA 4.21E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0123863533 NA 3.90E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 1.30E-08 mr1028 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 4.66E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 6.17E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 1.82E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 2.14E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 3.52E-07 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 5.53E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 1.58E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 6.18E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 4.74E-07 4.74E-07 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 4.18E-06 4.18E-06 mr1373 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 1.58E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 1.72E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 2.12E-07 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 4.40E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 2.63E-08 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 2.44E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 9.65E-07 mr1683 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 1.86E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 4.49E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 1.54E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 4.57E-06 mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 3.35E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 9.02E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 9.52E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 5.72E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 8.02E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123863533 NA 3.92E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251