Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123862783:

Variant ID: vg0123862783 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23862783
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGAATATTAGAAGTAGAGTATTGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTCTGAATTAAAAATAAGGAATATTAGAAGTAGAGTATA[G/T,A]
AGTCCATATAGAAATACAATTAAGAAAAAAAACAGAAATTCGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATTTAAAA

Reverse complement sequence

TTTTAAATTTCTATATGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGAATTTCTGTTTTTTTTCTTAATTGTATTTCTATATGGACT[C/A,T]
TATACTCTACTTCTAATATTCCTTATTTTTAATTCAGAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCAATACTCTACTTCTAATATTCCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.00%	6.00%	17.60%	4.04%	A: 0.42%
All Indica	2759	76.70%	0.70%	19.57%	2.46%	A: 0.54%
All Japonica	1512	63.20%	17.20%	14.09%	5.49%	NA
Aus	269	61.30%	0.00%	23.79%	13.38%	A: 1.49%
Indica I	595	56.50%	1.00%	39.83%	2.69%	NA
Indica II	465	90.30%	1.10%	6.24%	2.37%	NA
Indica III	913	85.50%	0.00%	11.06%	2.19%	A: 1.20%
Indica Intermediate	786	73.80%	1.00%	22.01%	2.67%	A: 0.51%
Temperate Japonica	767	69.10%	27.00%	3.26%	0.65%	NA
Tropical Japonica	504	47.80%	9.30%	28.97%	13.89%	NA
Japonica Intermediate	241	76.80%	2.50%	17.43%	3.32%	NA
VI/Aromatic	96	93.80%	0.00%	5.21%	0.00%	A: 1.04%
Intermediate	90	81.10%	3.30%	11.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123862783	G -> T	LOC_Os01g42090.1	upstream_gene_variant ; 1898.0bp to feature; MODIFIER	silent_mutation	Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123862783	G -> T	LOC_Os01g42080.1	downstream_gene_variant ; 943.0bp to feature; MODIFIER	silent_mutation	Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123862783	G -> T	LOC_Os01g42080-LOC_Os01g42090	intergenic_region ; MODIFIER	silent_mutation	Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123862783	G -> A	LOC_Os01g42090.1	upstream_gene_variant ; 1898.0bp to feature; MODIFIER	silent_mutation	Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123862783	G -> A	LOC_Os01g42080.1	downstream_gene_variant ; 943.0bp to feature; MODIFIER	silent_mutation	Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123862783	G -> A	LOC_Os01g42080-LOC_Os01g42090	intergenic_region ; MODIFIER	silent_mutation	Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0123862783	G -> DEL	N	N	silent_mutation	Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123862783	NA	1.83E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	5.12E-07	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	6.99E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	1.50E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	3.47E-06	mr1245	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	4.32E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	2.00E-07	2.00E-07	mr1369	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	3.29E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	2.73E-06	2.72E-06	mr1373	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	5.57E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	1.86E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	2.30E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	1.35E-06	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	9.59E-06	4.17E-06	mr1470	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	7.33E-06	7.32E-06	mr1470	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	4.42E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	3.86E-07	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	8.40E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	5.82E-06	mr1921	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783	NA	7.51E-06	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251