\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123862783:

Variant ID: vg0123862783 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23862783
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGAATATTAGAAGTAGAGTATTGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTCTGAATTAAAAATAAGGAATATTAGAAGTAGAGTATA[G/T,A]
AGTCCATATAGAAATACAATTAAGAAAAAAAACAGAAATTCGGAATTAAAAAATAAGAAATATTAGAAGTAGAGTATAGAGTCCATATAGAAATTTAAAA

Reverse complement sequence

TTTTAAATTTCTATATGGACTCTATACTCTACTTCTAATATTTCTTATTTTTTAATTCCGAATTTCTGTTTTTTTTCTTAATTGTATTTCTATATGGACT[C/A,T]
TATACTCTACTTCTAATATTCCTTATTTTTAATTCAGAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCAATACTCTACTTCTAATATTCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 6.00% 17.60% 4.04% A: 0.42%
All Indica  2759 76.70% 0.70% 19.57% 2.46% A: 0.54%
All Japonica  1512 63.20% 17.20% 14.09% 5.49% NA
Aus  269 61.30% 0.00% 23.79% 13.38% A: 1.49%
Indica I  595 56.50% 1.00% 39.83% 2.69% NA
Indica II  465 90.30% 1.10% 6.24% 2.37% NA
Indica III  913 85.50% 0.00% 11.06% 2.19% A: 1.20%
Indica Intermediate  786 73.80% 1.00% 22.01% 2.67% A: 0.51%
Temperate Japonica  767 69.10% 27.00% 3.26% 0.65% NA
Tropical Japonica  504 47.80% 9.30% 28.97% 13.89% NA
Japonica Intermediate  241 76.80% 2.50% 17.43% 3.32% NA
VI/Aromatic  96 93.80% 0.00% 5.21% 0.00% A: 1.04%
Intermediate  90 81.10% 3.30% 11.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123862783 G -> T LOC_Os01g42090.1 upstream_gene_variant ; 1898.0bp to feature; MODIFIER silent_mutation Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123862783 G -> T LOC_Os01g42080.1 downstream_gene_variant ; 943.0bp to feature; MODIFIER silent_mutation Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123862783 G -> T LOC_Os01g42080-LOC_Os01g42090 intergenic_region ; MODIFIER silent_mutation Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123862783 G -> A LOC_Os01g42090.1 upstream_gene_variant ; 1898.0bp to feature; MODIFIER silent_mutation Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123862783 G -> A LOC_Os01g42080.1 downstream_gene_variant ; 943.0bp to feature; MODIFIER silent_mutation Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123862783 G -> A LOC_Os01g42080-LOC_Os01g42090 intergenic_region ; MODIFIER silent_mutation Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0123862783 G -> DEL N N silent_mutation Average:21.559; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123862783 NA 1.83E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 5.12E-07 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 6.99E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 1.50E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 3.47E-06 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 4.32E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 2.00E-07 2.00E-07 mr1369 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 3.29E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 2.73E-06 2.72E-06 mr1373 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 5.57E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 1.86E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 2.30E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 1.35E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 9.59E-06 4.17E-06 mr1470 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 7.33E-06 7.32E-06 mr1470 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 4.42E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 3.86E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 8.40E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 5.82E-06 mr1921 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123862783 NA 7.51E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251