| Variant ID: vg0123789351 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23789351 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.00, others allele: 0.00, population size: 218. )
TGGACTTGAGCTACACTTCTTTAGAGGTTGTTGTGGGTTCCACATGGACTCCTCCATTCAAGTTAATCAGAGCACAACTGGCTTCATGTCAACTGGGTCC[G/T]
GGATTTCCTATCTTGTTTAAACACCAAAAGGGCATTATCTACATTGATGTTTCAAATGCAGGCATAGCCGATGCAATCCCAAGTTGGTTTTGGGATGAAA
TTTCATCCCAAAACCAACTTGGGATTGCATCGGCTATGCCTGCATTTGAAACATCAATGTAGATAATGCCCTTTTGGTGTTTAAACAAGATAGGAAATCC[C/A]
GGACCCAGTTGACATGAAGCCAGTTGTGCTCTGATTAACTTGAATGGAGGAGTCCATGTGGAACCCACAACAACCTCTAAAGAAGTGTAGCTCAAGTCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 21.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 38.20% | 61.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 59.70% | 40.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.50% | 58.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123789351 | G -> T | LOC_Os01g41950.1 | downstream_gene_variant ; 3576.0bp to feature; MODIFIER | silent_mutation | Average:49.14; most accessible tissue: Zhenshan97 flower, score: 66.841 | N | N | N | N |
| vg0123789351 | G -> T | LOC_Os01g41960.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.14; most accessible tissue: Zhenshan97 flower, score: 66.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123789351 | 4.36E-07 | NA | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | 3.17E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | 1.07E-06 | 1.07E-06 | mr1313 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | NA | 7.41E-16 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | 6.00E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | NA | 3.19E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | NA | 1.74E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | NA | 4.84E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123789351 | NA | 5.98E-11 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |