Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123735612:

Variant ID: vg0123735612 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23735612
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, A: 0.37, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGCCTCTCTGTTTGAGCCGCTGCGGTGCGCTGAAACAGCCATGAAAACAGCCACAGGTGGATCCCTACAGGCTACAGCGCCACACTGCAAGTCTGCAG[A/C]
GGCTGGGCGAAAAGATGATGATGGCATCGGGGTCGCCGCGTCCGTCCACTGCAGCTGCTTTCCTTTCACTCGCCATTCCTCACACTCACCTCGCCCACGG

Reverse complement sequence

CCGTGGGCGAGGTGAGTGTGAGGAATGGCGAGTGAAAGGAAAGCAGCTGCAGTGGACGGACGCGGCGACCCCGATGCCATCATCATCTTTTCGCCCAGCC[T/G]
CTGCAGACTTGCAGTGTGGCGCTGTAGCCTGTAGGGATCCACCTGTGGCTGTTTTCATGGCTGTTTCAGCGCACCGCAGCGGCTCAAACAGAGAGGCTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	25.40%	0.11%	0.00%	NA
All Indica	2759	97.70%	2.30%	0.04%	0.00%	NA
All Japonica	1512	27.10%	72.70%	0.26%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.30%	2.50%	0.17%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.70%	4.30%	0.00%	0.00%	NA
Temperate Japonica	767	14.70%	84.90%	0.39%	0.00%	NA
Tropical Japonica	504	39.50%	60.30%	0.20%	0.00%	NA
Japonica Intermediate	241	40.20%	59.80%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123735612	A -> C	LOC_Os01g41870.1	downstream_gene_variant ; 2532.0bp to feature; MODIFIER	silent_mutation	Average:87.578; most accessible tissue: Zhenshan97 panicle, score: 97.869	N	N	N	N
vg0123735612	A -> C	LOC_Os01g41870.2	downstream_gene_variant ; 2535.0bp to feature; MODIFIER	silent_mutation	Average:87.578; most accessible tissue: Zhenshan97 panicle, score: 97.869	N	N	N	N
vg0123735612	A -> C	LOC_Os01g41870-LOC_Os01g41880	intergenic_region ; MODIFIER	silent_mutation	Average:87.578; most accessible tissue: Zhenshan97 panicle, score: 97.869	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0123735612	A	C	0.05	0.02	0.02	-0.05	-0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123735612	7.90E-07	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	1.69E-07	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	9.53E-06	NA	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	4.18E-07	NA	mr1100	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	NA	1.30E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	2.03E-08	NA	mr1140	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	8.92E-07	NA	mr1203	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	NA	9.69E-17	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	NA	1.18E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	2.20E-08	NA	mr1618	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	6.13E-06	6.13E-06	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	NA	2.54E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123735612	NA	4.96E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251