Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123683673:

Variant ID: vg0123683673 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23683673
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTCCAATTTCTCCGTCACATCAAATGTTTGGACACATATATGTAGCATCAATTGTGGACGAAAAAAACCAATTGCACAGTCCGACTGTAAATTGCGAG[G/A]
CGAATATTTTGAGCCTAATTACGCCATGATTTGATAATGTGATACTACAGTAAACATTTGCTAATGACTGATTAATTATACTTAATAAATTCTTCTCGCA

Reverse complement sequence

TGCGAGAAGAATTTATTAAGTATAATTAATCAGTCATTAGCAAATGTTTACTGTAGTATCACATTATCAAATCATGGCGTAATTAGGCTCAAAATATTCG[C/T]
CTCGCAATTTACAGTCGGACTGTGCAATTGGTTTTTTTCGTCCACAATTGATGCTACATATATGTGTCCAAACATTTGATGTGACGGAGAAATTGGAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.90% 0.08% 0.00% NA
All Indica  2759 55.10% 44.80% 0.14% 0.00% NA
All Japonica  1512 91.30% 8.70% 0.00% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 62.00% 37.80% 0.17% 0.00% NA
Indica II  465 17.00% 82.80% 0.22% 0.00% NA
Indica III  913 75.00% 24.90% 0.11% 0.00% NA
Indica Intermediate  786 49.20% 50.60% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 77.00% 23.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123683673 G -> A LOC_Os01g41834.1 downstream_gene_variant ; 4616.0bp to feature; MODIFIER silent_mutation Average:30.717; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0123683673 G -> A LOC_Os01g41820.1 intron_variant ; MODIFIER silent_mutation Average:30.717; most accessible tissue: Minghui63 root, score: 52.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123683673 NA 5.40E-22 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0123683673 NA 1.13E-20 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0123683673 NA 1.26E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 9.24E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.99E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.93E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.15E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.47E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.03E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.66E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 7.53E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.84E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.20E-11 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.49E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.44E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.06E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.49E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.33E-08 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.01E-08 mr1735 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.65E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.61E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.73E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 9.10E-07 mr1960 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.82E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.96E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 9.69E-07 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.00E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.63E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.02E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.84E-08 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.85E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.78E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.75E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 7.87E-07 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.35E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.19E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.12E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.45E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.73E-10 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.26E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.03E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 7.32E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.02E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.79E-09 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.64E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.36E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.09E-07 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.81E-10 mr1268_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.14E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.31E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.60E-06 mr1283_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.47E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.37E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.04E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.78E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.54E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.69E-10 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.71E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 7.87E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 9.64E-24 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 9.37E-14 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.43E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.14E-07 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.61E-10 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.15E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.09E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.77E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.09E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.25E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.79E-08 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.96E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.78E-10 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.30E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.04E-07 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 9.93E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.94E-08 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.82E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.06E-24 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.15E-13 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.01E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.67E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.58E-09 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 9.25E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.78E-08 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.35E-07 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.51E-13 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.78E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.95E-09 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.21E-09 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 8.67E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.17E-07 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.92E-06 mr1787_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.71E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.95E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.17E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.87E-07 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.81E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 7.76E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.61E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 4.92E-09 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.00E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.17E-07 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 6.44E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.60E-07 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 2.46E-06 mr1944_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 7.74E-09 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 1.75E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 5.45E-10 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.42E-07 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123683673 NA 3.58E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251