\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123678952:

Variant ID: vg0123678952 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23678952
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGTAACTCGCCCGCTGTCTACTCTCTTTAATGTCATTAATATTTTAAAAAATGAATACGATTGTCATTGTGGTTTTTTTTTTACTTTCTAGAAGTCCC[G/A]
CCAACCGCTATGATCATGTTGCTTAATGGCCTGCCCGTCGTCCCTACTCTTAATCGTTATTGGGATTCTATTTGGGATTTTGTTTATAATTTTTAGATGT

Reverse complement sequence

ACATCTAAAAATTATAAACAAAATCCCAAATAGAATCCCAATAACGATTAAGAGTAGGGACGACGGGCAGGCCATTAAGCAACATGATCATAGCGGTTGG[C/T]
GGGACTTCTAGAAAGTAAAAAAAAAACCACAATGACAATCGTATTCATTTTTTAAAATATTAATGACATTAAAGAGAGTAGACAGCGGGCGAGTTACAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 11.10% 1.59% 1.33% NA
All Indica  2759 79.00% 17.80% 1.78% 1.41% NA
All Japonica  1512 96.20% 1.90% 0.86% 0.99% NA
Aus  269 98.10% 0.00% 1.12% 0.74% NA
Indica I  595 92.60% 2.20% 4.54% 0.67% NA
Indica II  465 94.60% 3.40% 0.65% 1.29% NA
Indica III  913 61.40% 35.40% 0.99% 2.19% NA
Indica Intermediate  786 79.90% 17.70% 1.27% 1.15% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 91.30% 4.80% 2.18% 1.79% NA
Japonica Intermediate  241 95.00% 1.70% 0.83% 2.49% NA
VI/Aromatic  96 87.50% 0.00% 7.29% 5.21% NA
Intermediate  90 90.00% 4.40% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123678952 G -> A LOC_Os01g41810.1 upstream_gene_variant ; 3083.0bp to feature; MODIFIER silent_mutation Average:41.973; most accessible tissue: Callus, score: 62.886 N N N N
vg0123678952 G -> A LOC_Os01g41820.1 downstream_gene_variant ; 3430.0bp to feature; MODIFIER silent_mutation Average:41.973; most accessible tissue: Callus, score: 62.886 N N N N
vg0123678952 G -> A LOC_Os01g41810-LOC_Os01g41820 intergenic_region ; MODIFIER silent_mutation Average:41.973; most accessible tissue: Callus, score: 62.886 N N N N
vg0123678952 G -> DEL N N silent_mutation Average:41.973; most accessible tissue: Callus, score: 62.886 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123678952 NA 1.25E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.19E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 9.79E-07 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.27E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 2.55E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 2.46E-09 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 2.15E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 5.89E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 8.56E-11 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 8.76E-08 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.00E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.06E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 3.69E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 5.39E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.27E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 7.88E-12 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 3.55E-10 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 2.17E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.53E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.80E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 4.33E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 2.28E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 2.53E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 7.94E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 2.82E-06 3.73E-09 mr1973_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 2.44E-08 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952 NA 1.32E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251