\
| Variant ID: vg0123678952 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23678952 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTGTAACTCGCCCGCTGTCTACTCTCTTTAATGTCATTAATATTTTAAAAAATGAATACGATTGTCATTGTGGTTTTTTTTTTACTTTCTAGAAGTCCC[G/A]
CCAACCGCTATGATCATGTTGCTTAATGGCCTGCCCGTCGTCCCTACTCTTAATCGTTATTGGGATTCTATTTGGGATTTTGTTTATAATTTTTAGATGT
ACATCTAAAAATTATAAACAAAATCCCAAATAGAATCCCAATAACGATTAAGAGTAGGGACGACGGGCAGGCCATTAAGCAACATGATCATAGCGGTTGG[C/T]
GGGACTTCTAGAAAGTAAAAAAAAAACCACAATGACAATCGTATTCATTTTTTAAAATATTAATGACATTAAAGAGAGTAGACAGCGGGCGAGTTACAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 11.10% | 1.59% | 1.33% | NA |
| All Indica | 2759 | 79.00% | 17.80% | 1.78% | 1.41% | NA |
| All Japonica | 1512 | 96.20% | 1.90% | 0.86% | 0.99% | NA |
| Aus | 269 | 98.10% | 0.00% | 1.12% | 0.74% | NA |
| Indica I | 595 | 92.60% | 2.20% | 4.54% | 0.67% | NA |
| Indica II | 465 | 94.60% | 3.40% | 0.65% | 1.29% | NA |
| Indica III | 913 | 61.40% | 35.40% | 0.99% | 2.19% | NA |
| Indica Intermediate | 786 | 79.90% | 17.70% | 1.27% | 1.15% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 4.80% | 2.18% | 1.79% | NA |
| Japonica Intermediate | 241 | 95.00% | 1.70% | 0.83% | 2.49% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 7.29% | 5.21% | NA |
| Intermediate | 90 | 90.00% | 4.40% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123678952 | G -> A | LOC_Os01g41810.1 | upstream_gene_variant ; 3083.0bp to feature; MODIFIER | silent_mutation | Average:41.973; most accessible tissue: Callus, score: 62.886 | N | N | N | N |
| vg0123678952 | G -> A | LOC_Os01g41820.1 | downstream_gene_variant ; 3430.0bp to feature; MODIFIER | silent_mutation | Average:41.973; most accessible tissue: Callus, score: 62.886 | N | N | N | N |
| vg0123678952 | G -> A | LOC_Os01g41810-LOC_Os01g41820 | intergenic_region ; MODIFIER | silent_mutation | Average:41.973; most accessible tissue: Callus, score: 62.886 | N | N | N | N |
| vg0123678952 | G -> DEL | N | N | silent_mutation | Average:41.973; most accessible tissue: Callus, score: 62.886 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123678952 | NA | 1.25E-06 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.19E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 9.79E-07 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.27E-07 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 2.55E-08 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 2.46E-09 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 2.15E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 5.89E-09 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 8.56E-11 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 8.76E-08 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.00E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.06E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 3.69E-06 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 5.39E-07 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.27E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 7.88E-12 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 3.55E-10 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 2.17E-07 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.53E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.80E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 4.33E-07 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 2.28E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 2.53E-08 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 7.94E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | 2.82E-06 | 3.73E-09 | mr1973_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 2.44E-08 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123678952 | NA | 1.32E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |