Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123678952:

Variant ID: vg0123678952 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23678952
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTGTAACTCGCCCGCTGTCTACTCTCTTTAATGTCATTAATATTTTAAAAAATGAATACGATTGTCATTGTGGTTTTTTTTTTACTTTCTAGAAGTCCC[G/A]
CCAACCGCTATGATCATGTTGCTTAATGGCCTGCCCGTCGTCCCTACTCTTAATCGTTATTGGGATTCTATTTGGGATTTTGTTTATAATTTTTAGATGT

Reverse complement sequence

ACATCTAAAAATTATAAACAAAATCCCAAATAGAATCCCAATAACGATTAAGAGTAGGGACGACGGGCAGGCCATTAAGCAACATGATCATAGCGGTTGG[C/T]
GGGACTTCTAGAAAGTAAAAAAAAAACCACAATGACAATCGTATTCATTTTTTAAAATATTAATGACATTAAAGAGAGTAGACAGCGGGCGAGTTACAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	11.10%	1.59%	1.33%	NA
All Indica	2759	79.00%	17.80%	1.78%	1.41%	NA
All Japonica	1512	96.20%	1.90%	0.86%	0.99%	NA
Aus	269	98.10%	0.00%	1.12%	0.74%	NA
Indica I	595	92.60%	2.20%	4.54%	0.67%	NA
Indica II	465	94.60%	3.40%	0.65%	1.29%	NA
Indica III	913	61.40%	35.40%	0.99%	2.19%	NA
Indica Intermediate	786	79.90%	17.70%	1.27%	1.15%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	91.30%	4.80%	2.18%	1.79%	NA
Japonica Intermediate	241	95.00%	1.70%	0.83%	2.49%	NA
VI/Aromatic	96	87.50%	0.00%	7.29%	5.21%	NA
Intermediate	90	90.00%	4.40%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123678952	G -> A	LOC_Os01g41810.1	upstream_gene_variant ; 3083.0bp to feature; MODIFIER	silent_mutation	Average:41.973; most accessible tissue: Callus, score: 62.886	N	N	N	N
vg0123678952	G -> A	LOC_Os01g41820.1	downstream_gene_variant ; 3430.0bp to feature; MODIFIER	silent_mutation	Average:41.973; most accessible tissue: Callus, score: 62.886	N	N	N	N
vg0123678952	G -> A	LOC_Os01g41810-LOC_Os01g41820	intergenic_region ; MODIFIER	silent_mutation	Average:41.973; most accessible tissue: Callus, score: 62.886	N	N	N	N
vg0123678952	G -> DEL	N	N	silent_mutation	Average:41.973; most accessible tissue: Callus, score: 62.886	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123678952	NA	1.25E-06	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.19E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	9.79E-07	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.27E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	2.55E-08	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	2.46E-09	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	2.15E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	5.89E-09	mr1234	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	8.56E-11	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	8.76E-08	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.00E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.06E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	3.69E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	5.39E-07	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.27E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	7.88E-12	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	3.55E-10	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	2.17E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.53E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.80E-07	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	4.33E-07	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	2.28E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	2.53E-08	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	7.94E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	2.82E-06	3.73E-09	mr1973_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	2.44E-08	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123678952	NA	1.32E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251