Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0123668591:

Variant ID: vg0123668591 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23668591
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.06, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGCGCTCGGAGGTGACAGTGACACGAGCAGAAGCGAGAGTCCGAGCCATGGGAACACACATACGCTGCTGCCTGCTGGACTCGGAGACGAAACGGTGG[T/C]
GGCTTGAATAATGGCTTTGATCTTATCAACGTCCACAATGTCCTTTGCTCATATCGATGTGGAAGTGTAAGGTGTTTTTTTTTGTTCATTTTCGGTCAAT

Reverse complement sequence

ATTGACCGAAAATGAACAAAAAAAAACACCTTACACTTCCACATCGATATGAGCAAAGGACATTGTGGACGTTGATAAGATCAAAGCCATTATTCAAGCC[A/G]
CCACCGTTTCGTCTCCGAGTCCAGCAGGCAGCAGCGTATGTGTGTTCCCATGGCTCGGACTCTCGCTTCTGCTCGTGTCACTGTCACCTCCGAGCGCAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.10% 0.15% 0.00% NA
All Indica  2759 48.70% 51.00% 0.22% 0.00% NA
All Japonica  1512 92.20% 7.80% 0.00% 0.00% NA
Aus  269 9.30% 90.70% 0.00% 0.00% NA
Indica I  595 13.90% 85.70% 0.34% 0.00% NA
Indica II  465 41.10% 58.70% 0.22% 0.00% NA
Indica III  913 76.70% 23.20% 0.11% 0.00% NA
Indica Intermediate  786 47.20% 52.50% 0.25% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 85.30% 14.70% 0.00% 0.00% NA
Japonica Intermediate  241 83.00% 17.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123668591 T -> C LOC_Os01g41800.1 upstream_gene_variant ; 4147.0bp to feature; MODIFIER silent_mutation Average:87.618; most accessible tissue: Zhenshan97 root, score: 93.669 N N N N
vg0123668591 T -> C LOC_Os01g41810.1 downstream_gene_variant ; 4701.0bp to feature; MODIFIER silent_mutation Average:87.618; most accessible tissue: Zhenshan97 root, score: 93.669 N N N N
vg0123668591 T -> C LOC_Os01g41800-LOC_Os01g41810 intergenic_region ; MODIFIER silent_mutation Average:87.618; most accessible tissue: Zhenshan97 root, score: 93.669 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123668591 T C 0.02 -0.05 -0.05 -0.07 -0.09 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123668591 NA 1.32E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 4.44E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 1.19E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 6.38E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 2.40E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 4.83E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 3.00E-12 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 8.20E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 4.91E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 8.54E-06 3.99E-14 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 5.76E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 4.93E-11 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 1.02E-06 1.59E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 3.50E-06 9.29E-13 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 1.38E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123668591 NA 3.30E-12 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251