\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123665592:

Variant ID: vg0123665592 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23665592
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTAAAACTAACTAAAATTCGAAAAAAAAGAAGCCTCCACGTTCACTCTCATGACTTATAAATTCTCACATTAATCGGAGAAAAAGAAAAAGCAGAAT[C/G]
CATATAAAAATACAATTTAGAATAGCTGAAATTCGAAATTAAAAAATAAGAAATATTAAAAGAGTAGACTAGAGTCCATATAGAAATACAATTTAGAAAT

Reverse complement sequence

ATTTCTAAATTGTATTTCTATATGGACTCTAGTCTACTCTTTTAATATTTCTTATTTTTTAATTTCGAATTTCAGCTATTCTAAATTGTATTTTTATATG[G/C]
ATTCTGCTTTTTCTTTTTCTCCGATTAATGTGAGAATTTATAAGTCATGAGAGTGAACGTGGAGGCTTCTTTTTTTTCGAATTTTAGTTAGTTTTAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.50% 34.90% 1.57% 19.04% NA
All Indica  2759 22.70% 49.90% 1.92% 25.48% NA
All Japonica  1512 88.40% 0.90% 0.40% 10.32% NA
Aus  269 3.00% 84.80% 4.09% 8.18% NA
Indica I  595 5.40% 85.20% 3.87% 5.55% NA
Indica II  465 8.80% 57.00% 0.65% 33.55% NA
Indica III  913 39.50% 22.20% 0.66% 37.57% NA
Indica Intermediate  786 24.40% 51.10% 2.67% 21.76% NA
Temperate Japonica  767 95.20% 0.10% 0.52% 4.17% NA
Tropical Japonica  504 77.00% 0.40% 0.00% 22.62% NA
Japonica Intermediate  241 90.90% 4.10% 0.83% 4.15% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 50.00% 25.60% 3.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123665592 C -> G LOC_Os01g41800.1 upstream_gene_variant ; 1148.0bp to feature; MODIFIER silent_mutation Average:11.259; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0123665592 C -> G LOC_Os01g41800-LOC_Os01g41810 intergenic_region ; MODIFIER silent_mutation Average:11.259; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0123665592 C -> DEL N N silent_mutation Average:11.259; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123665592 NA 4.25E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 5.84E-08 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 1.66E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 6.22E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 6.31E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 9.88E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 1.12E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 4.68E-12 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 5.42E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 5.10E-06 1.09E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 7.00E-06 1.52E-13 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 3.09E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 4.37E-06 NA mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 7.64E-06 8.22E-11 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 5.21E-07 1.16E-06 mr1908_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 1.74E-06 1.11E-12 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 1.02E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123665592 NA 4.28E-11 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251