Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123660341:

Variant ID: vg0123660341 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23660341
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.46, C: 0.45, T: 0.09, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAAAGAAAAATAATAAAAAATAGGTTCACCATTTCTTTTACTCCTACTTTTCTCCATGTGAATATGGCTTGATCATAAATGTTATGCCTCATCCATTT[A/C,T]
TGTATGGCCTGGTTTGGGTGTATTATCGATGTACACCCATAGGTTTTTTGAATTAAGCATGGTGCTTAGGTTGAAATAGTATGCTTTAATCAAATTAGAC

Reverse complement sequence

GTCTAATTTGATTAAAGCATACTATTTCAACCTAAGCACCATGCTTAATTCAAAAAACCTATGGGTGTACATCGATAATACACCCAAACCAGGCCATACA[T/G,A]
AAATGGATGAGGCATAACATTTATGATCAAGCCATATTCACATGGAGAAAAGTAGGAGTAAAAGAAATGGTGAACCTATTTTTTATTATTTTTCTTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	24.70%	0.68%	6.56%	T: 0.02%
All Indica	2759	91.40%	2.10%	0.43%	6.05%	NA
All Japonica	1512	18.30%	71.10%	1.32%	9.33%	NA
Aus	269	98.10%	1.50%	0.00%	0.37%	NA
Indica I	595	97.00%	1.50%	1.34%	0.17%	NA
Indica II	465	96.30%	2.20%	0.00%	1.51%	NA
Indica III	913	84.80%	0.70%	0.22%	14.35%	NA
Indica Intermediate	786	92.10%	4.10%	0.25%	3.56%	NA
Temperate Japonica	767	0.80%	93.40%	1.43%	4.43%	NA
Tropical Japonica	504	42.70%	43.80%	0.99%	12.50%	NA
Japonica Intermediate	241	22.80%	57.30%	1.66%	18.26%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	32.20%	0.00%	1.11%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123660341	A -> T	LOC_Os01g41790.1	upstream_gene_variant ; 2025.0bp to feature; MODIFIER	silent_mutation	Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0123660341	A -> T	LOC_Os01g41800.1	downstream_gene_variant ; 2718.0bp to feature; MODIFIER	silent_mutation	Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0123660341	A -> T	LOC_Os01g41790-LOC_Os01g41800	intergenic_region ; MODIFIER	silent_mutation	Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0123660341	A -> DEL	N	N	silent_mutation	Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0123660341	A -> C	LOC_Os01g41790.1	upstream_gene_variant ; 2025.0bp to feature; MODIFIER	silent_mutation	Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0123660341	A -> C	LOC_Os01g41800.1	downstream_gene_variant ; 2718.0bp to feature; MODIFIER	silent_mutation	Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0123660341	A -> C	LOC_Os01g41790-LOC_Os01g41800	intergenic_region ; MODIFIER	silent_mutation	Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123660341	NA	1.50E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0123660341	NA	1.68E-31	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	9.48E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	1.10E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	8.99E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	5.60E-07	NA	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	6.85E-06	NA	mr1023_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	4.22E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	1.13E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	3.59E-07	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	5.81E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	1.72E-08	NA	mr1489_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	1.40E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341	NA	7.13E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251