\
| Variant ID: vg0123660341 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23660341 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.46, C: 0.45, T: 0.09, others allele: 0.00, population size: 80. )
TAAAAAGAAAAATAATAAAAAATAGGTTCACCATTTCTTTTACTCCTACTTTTCTCCATGTGAATATGGCTTGATCATAAATGTTATGCCTCATCCATTT[A/C,T]
TGTATGGCCTGGTTTGGGTGTATTATCGATGTACACCCATAGGTTTTTTGAATTAAGCATGGTGCTTAGGTTGAAATAGTATGCTTTAATCAAATTAGAC
GTCTAATTTGATTAAAGCATACTATTTCAACCTAAGCACCATGCTTAATTCAAAAAACCTATGGGTGTACATCGATAATACACCCAAACCAGGCCATACA[T/G,A]
AAATGGATGAGGCATAACATTTATGATCAAGCCATATTCACATGGAGAAAAGTAGGAGTAAAAGAAATGGTGAACCTATTTTTTATTATTTTTCTTTTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 24.70% | 0.68% | 6.56% | T: 0.02% |
| All Indica | 2759 | 91.40% | 2.10% | 0.43% | 6.05% | NA |
| All Japonica | 1512 | 18.30% | 71.10% | 1.32% | 9.33% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.00% | 1.50% | 1.34% | 0.17% | NA |
| Indica II | 465 | 96.30% | 2.20% | 0.00% | 1.51% | NA |
| Indica III | 913 | 84.80% | 0.70% | 0.22% | 14.35% | NA |
| Indica Intermediate | 786 | 92.10% | 4.10% | 0.25% | 3.56% | NA |
| Temperate Japonica | 767 | 0.80% | 93.40% | 1.43% | 4.43% | NA |
| Tropical Japonica | 504 | 42.70% | 43.80% | 0.99% | 12.50% | NA |
| Japonica Intermediate | 241 | 22.80% | 57.30% | 1.66% | 18.26% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 32.20% | 0.00% | 1.11% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123660341 | A -> T | LOC_Os01g41790.1 | upstream_gene_variant ; 2025.0bp to feature; MODIFIER | silent_mutation | Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0123660341 | A -> T | LOC_Os01g41800.1 | downstream_gene_variant ; 2718.0bp to feature; MODIFIER | silent_mutation | Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0123660341 | A -> T | LOC_Os01g41790-LOC_Os01g41800 | intergenic_region ; MODIFIER | silent_mutation | Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0123660341 | A -> DEL | N | N | silent_mutation | Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0123660341 | A -> C | LOC_Os01g41790.1 | upstream_gene_variant ; 2025.0bp to feature; MODIFIER | silent_mutation | Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0123660341 | A -> C | LOC_Os01g41800.1 | downstream_gene_variant ; 2718.0bp to feature; MODIFIER | silent_mutation | Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0123660341 | A -> C | LOC_Os01g41790-LOC_Os01g41800 | intergenic_region ; MODIFIER | silent_mutation | Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123660341 | NA | 1.50E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0123660341 | NA | 1.68E-31 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 9.48E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 1.10E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 8.99E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | 5.60E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | 6.85E-06 | NA | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 4.22E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 1.13E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | 3.59E-07 | NA | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 5.81E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | 1.72E-08 | NA | mr1489_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 1.40E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123660341 | NA | 7.13E-06 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |