\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123660341:

Variant ID: vg0123660341 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23660341
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.46, C: 0.45, T: 0.09, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAAGAAAAATAATAAAAAATAGGTTCACCATTTCTTTTACTCCTACTTTTCTCCATGTGAATATGGCTTGATCATAAATGTTATGCCTCATCCATTT[A/C,T]
TGTATGGCCTGGTTTGGGTGTATTATCGATGTACACCCATAGGTTTTTTGAATTAAGCATGGTGCTTAGGTTGAAATAGTATGCTTTAATCAAATTAGAC

Reverse complement sequence

GTCTAATTTGATTAAAGCATACTATTTCAACCTAAGCACCATGCTTAATTCAAAAAACCTATGGGTGTACATCGATAATACACCCAAACCAGGCCATACA[T/G,A]
AAATGGATGAGGCATAACATTTATGATCAAGCCATATTCACATGGAGAAAAGTAGGAGTAAAAGAAATGGTGAACCTATTTTTTATTATTTTTCTTTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 24.70% 0.68% 6.56% T: 0.02%
All Indica  2759 91.40% 2.10% 0.43% 6.05% NA
All Japonica  1512 18.30% 71.10% 1.32% 9.33% NA
Aus  269 98.10% 1.50% 0.00% 0.37% NA
Indica I  595 97.00% 1.50% 1.34% 0.17% NA
Indica II  465 96.30% 2.20% 0.00% 1.51% NA
Indica III  913 84.80% 0.70% 0.22% 14.35% NA
Indica Intermediate  786 92.10% 4.10% 0.25% 3.56% NA
Temperate Japonica  767 0.80% 93.40% 1.43% 4.43% NA
Tropical Japonica  504 42.70% 43.80% 0.99% 12.50% NA
Japonica Intermediate  241 22.80% 57.30% 1.66% 18.26% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 65.60% 32.20% 0.00% 1.11% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123660341 A -> T LOC_Os01g41790.1 upstream_gene_variant ; 2025.0bp to feature; MODIFIER silent_mutation Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0123660341 A -> T LOC_Os01g41800.1 downstream_gene_variant ; 2718.0bp to feature; MODIFIER silent_mutation Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0123660341 A -> T LOC_Os01g41790-LOC_Os01g41800 intergenic_region ; MODIFIER silent_mutation Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0123660341 A -> DEL N N silent_mutation Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0123660341 A -> C LOC_Os01g41790.1 upstream_gene_variant ; 2025.0bp to feature; MODIFIER silent_mutation Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0123660341 A -> C LOC_Os01g41800.1 downstream_gene_variant ; 2718.0bp to feature; MODIFIER silent_mutation Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0123660341 A -> C LOC_Os01g41790-LOC_Os01g41800 intergenic_region ; MODIFIER silent_mutation Average:31.533; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123660341 NA 1.50E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0123660341 NA 1.68E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 9.48E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 1.10E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 8.99E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 5.60E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 6.85E-06 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 4.22E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 1.13E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 3.59E-07 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 5.81E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 1.72E-08 NA mr1489_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 1.40E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123660341 NA 7.13E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251