\
| Variant ID: vg0123658680 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23658680 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 86. )
TCCCTCGGCGGTTTGGATAGCAGTTTTGGCCAACGTGGCTAATTTGACTTAGACTTCATCTGATGTAGCATTGACGTCGCACTTACGTGGCAATTTTATC[T/C]
GAAAAAATAATAAACCTCGTGGGACCCACATGTCAGTTTCACACAAAAAAATATTTTTAAAAGGTGGGCCCACGTGGGCCCCACATGTCATTCTCATCCC
GGGATGAGAATGACATGTGGGGCCCACGTGGGCCCACCTTTTAAAAATATTTTTTTGTGTGAAACTGACATGTGGGTCCCACGAGGTTTATTATTTTTTC[A/G]
GATAAAATTGCCACGTAAGTGCGACGTCAATGCTACATCAGATGAAGTCTAAGTCAAATTAGCCACGTTGGCCAAAACTGCTATCCAAACCGCCGAGGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 30.70% | 0.72% | 6.77% | NA |
| All Indica | 2759 | 87.10% | 5.90% | 0.76% | 6.20% | NA |
| All Japonica | 1512 | 17.90% | 72.00% | 0.33% | 9.72% | NA |
| Aus | 269 | 40.50% | 56.50% | 2.60% | 0.37% | NA |
| Indica I | 595 | 95.50% | 1.80% | 2.52% | 0.17% | NA |
| Indica II | 465 | 95.50% | 3.00% | 0.00% | 1.51% | NA |
| Indica III | 913 | 77.70% | 7.60% | 0.00% | 14.79% | NA |
| Indica Intermediate | 786 | 86.80% | 8.90% | 0.76% | 3.56% | NA |
| Temperate Japonica | 767 | 0.50% | 94.90% | 0.13% | 4.43% | NA |
| Tropical Japonica | 504 | 42.30% | 44.00% | 0.79% | 12.90% | NA |
| Japonica Intermediate | 241 | 22.40% | 57.70% | 0.00% | 19.92% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 38.90% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123658680 | T -> DEL | N | N | silent_mutation | Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0123658680 | T -> C | LOC_Os01g41790.1 | upstream_gene_variant ; 364.0bp to feature; MODIFIER | silent_mutation | Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0123658680 | T -> C | LOC_Os01g41800.1 | downstream_gene_variant ; 4379.0bp to feature; MODIFIER | silent_mutation | Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0123658680 | T -> C | LOC_Os01g41790-LOC_Os01g41800 | intergenic_region ; MODIFIER | silent_mutation | Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123658680 | NA | 2.47E-15 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 1.04E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 3.17E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 8.88E-33 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 1.68E-08 | mr1837 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 2.67E-11 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 7.66E-17 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 1.31E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123658680 | NA | 2.05E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |