Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123658680:

Variant ID: vg0123658680 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 23658680
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCTCGGCGGTTTGGATAGCAGTTTTGGCCAACGTGGCTAATTTGACTTAGACTTCATCTGATGTAGCATTGACGTCGCACTTACGTGGCAATTTTATC[T/C]
GAAAAAATAATAAACCTCGTGGGACCCACATGTCAGTTTCACACAAAAAAATATTTTTAAAAGGTGGGCCCACGTGGGCCCCACATGTCATTCTCATCCC

Reverse complement sequence

GGGATGAGAATGACATGTGGGGCCCACGTGGGCCCACCTTTTAAAAATATTTTTTTGTGTGAAACTGACATGTGGGTCCCACGAGGTTTATTATTTTTTC[A/G]
GATAAAATTGCCACGTAAGTGCGACGTCAATGCTACATCAGATGAAGTCTAAGTCAAATTAGCCACGTTGGCCAAAACTGCTATCCAAACCGCCGAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	30.70%	0.72%	6.77%	NA
All Indica	2759	87.10%	5.90%	0.76%	6.20%	NA
All Japonica	1512	17.90%	72.00%	0.33%	9.72%	NA
Aus	269	40.50%	56.50%	2.60%	0.37%	NA
Indica I	595	95.50%	1.80%	2.52%	0.17%	NA
Indica II	465	95.50%	3.00%	0.00%	1.51%	NA
Indica III	913	77.70%	7.60%	0.00%	14.79%	NA
Indica Intermediate	786	86.80%	8.90%	0.76%	3.56%	NA
Temperate Japonica	767	0.50%	94.90%	0.13%	4.43%	NA
Tropical Japonica	504	42.30%	44.00%	0.79%	12.90%	NA
Japonica Intermediate	241	22.40%	57.70%	0.00%	19.92%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	58.90%	38.90%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123658680	T -> DEL	N	N	silent_mutation	Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0123658680	T -> C	LOC_Os01g41790.1	upstream_gene_variant ; 364.0bp to feature; MODIFIER	silent_mutation	Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0123658680	T -> C	LOC_Os01g41800.1	downstream_gene_variant ; 4379.0bp to feature; MODIFIER	silent_mutation	Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0123658680	T -> C	LOC_Os01g41790-LOC_Os01g41800	intergenic_region ; MODIFIER	silent_mutation	Average:64.103; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123658680	NA	2.47E-15	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	1.04E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	3.17E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	8.88E-33	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	1.68E-08	mr1837	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	2.67E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	7.66E-17	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	1.31E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123658680	NA	2.05E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251