\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123622337:

Variant ID: vg0123622337 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23622337
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGGCAGGATTTCTTATATAGTTACCAAAATTTGGCAGCAAACTAAATGTACCCACTTTTTTTTGGTAACTTTACCAAAATTTGGTAAGGTTGAAAAT[G/A]
GCACAAAAGTAAACAGCCCCTAAGTTTAGTAATAAGCCTAAAGAAAGATGACCTAAAGAAAAGAGGATAAAGAGGATAAGAAGTGGGACAAGACGCTGGA

Reverse complement sequence

TCCAGCGTCTTGTCCCACTTCTTATCCTCTTTATCCTCTTTTCTTTAGGTCATCTTTCTTTAGGCTTATTACTAAACTTAGGGGCTGTTTACTTTTGTGC[C/T]
ATTTTCAACCTTACCAAATTTTGGTAAAGTTACCAAAAAAAAGTGGGTACATTTAGTTTGCTGCCAAATTTTGGTAACTATATAAGAAATCCTGCCAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 42.00% 3.32% 5.12% NA
All Indica  2759 38.20% 48.40% 5.18% 8.26% NA
All Japonica  1512 80.20% 18.50% 0.60% 0.73% NA
Aus  269 4.80% 95.20% 0.00% 0.00% NA
Indica I  595 4.50% 70.10% 13.78% 11.60% NA
Indica II  465 39.10% 43.40% 6.02% 11.40% NA
Indica III  913 57.00% 39.50% 0.22% 3.29% NA
Indica Intermediate  786 41.30% 45.00% 3.94% 9.67% NA
Temperate Japonica  767 98.80% 0.50% 0.65% 0.00% NA
Tropical Japonica  504 60.30% 38.10% 0.20% 1.39% NA
Japonica Intermediate  241 62.70% 34.40% 1.24% 1.66% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 62.20% 30.00% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123622337 G -> A LOC_Os01g41730.1 upstream_gene_variant ; 1952.0bp to feature; MODIFIER silent_mutation Average:44.395; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0123622337 G -> A LOC_Os01g41720-LOC_Os01g41730 intergenic_region ; MODIFIER silent_mutation Average:44.395; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0123622337 G -> DEL N N silent_mutation Average:44.395; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123622337 NA 4.69E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 9.50E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 9.79E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 2.31E-06 NA mr1587 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 9.17E-06 mr1587 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 1.57E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 5.46E-06 mr1908 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 1.88E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 1.35E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 1.01E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 1.16E-09 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 5.96E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 9.98E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 1.58E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 8.66E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 8.24E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 2.40E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123622337 NA 7.52E-09 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251